Question: STAR output soft-clipped reads instead of insertion
0
gravatar for jasonwufree2012
10 weeks ago by
jasonwufree201220 wrote:

Hi, all,

I used STAR to align reads to zebrafish genome. I know STAR output soft-clipped reads. But when I Blat the read to genome and find that actually there are only two insertions and one mismatch in the read.

The reads is

@NB501962:91:HVTHLBGX5:4:11603:19437:19319
CTCTGATTCAGTCTACTCAGACTTGATTGACCCATCACAGAGCTCAAGTTTAAATTCTGAGTTTGTTGACCCTCC
+
AAAAAEEEEEEEEEEEEEEEAEEEEEEEE/EEEAEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEAE/EEEEE

The STAR command I used is:

STAR --runThreadN 48 --genomeDir ./annotation --outFilterMismatchNoverLmax 0.05 --readFilesIn Read.fastq --outFileNamePrefix test_ --outSAMtype BAM SortedByCoordinate --outSAMattributes Standard

The result is:

NB501962:91:HVTHLBGX5:4:11603:19437:19319   0   1   6002    255 54M21S  *   0   0   CTCTGATTCAGTCTACTCAGACTTGATTGACCCATCACAGAGCTCAAGTTTAAATTCTGAGTTTGTTGACCCTCC AAAAAEEEEEEEEEEEEEEEAEEEEEEEE/EEEAEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEAE/EEEEE NH:i:1  HI:i:1  AS:i:53 nM:i:0

But when I check the genome browser and extract the sequence, the mapping should be like(underline is insertion):

 read:CTCTGATTCAGTCTACTCAGACTTGATTGACCCATCACAGAGCTCAAGTTTAAATTCTGAGTTTGTTGAcCCTCC
 gemo:CTCTGATTCAGTCTACTCAGACTTGATTGACCCATCACAGAGCTCAAGTTTAAA__CTGAGTTTGTTGAaCCTCC

I would expect it to be mapped as the whole read with insertion. But the 3' end sequence after insertion, STAR output it as unmapped (soft-clipped). If I use the EndtoEnd mode, this read can not be mapped to genome.

Can someone help me out with this? Or are there any parameters in STAR I can set to map this read properly?

Thank you in advance!

alignment • 138 views
ADD COMMENTlink modified 10 weeks ago • written 10 weeks ago by jasonwufree201220

Please use the formatting bar (especially the code option) to present your post better. I've done it for you this time.
code_formatting

Thank you!

ADD REPLYlink written 10 weeks ago by genomax68k

Thank you for the reminder. I was looking for the option to make it better. And you help me with it. Thanks!

ADD REPLYlink modified 10 weeks ago • written 10 weeks ago by jasonwufree201220
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1760 users visited in the last hour