Question: Error in MUSCLE
0
gravatar for mac03pat
6 months ago by
mac03pat10
mac03pat10 wrote:

Trying to run muscle on a file to build a tree. I successfully used muscle to align this file in .clw format yesterday. Now I tried running these two lines of code and received the same error each time. Anyone know what the error means and how to fix it?

 muscle -maketree -in seqs.afa -out seqs.phy

And I tried this:

  muscle -maketree -in seqs.afa -out seqs.phy -cluster neighborjoining

Error:

Internal error MSA::ExpandCache, ColCount change

I ran this code with success (output .afa and .phy):

   muscle -in seqs.fa -out seqs.afa -tree1 first.phy -maxiters 1

But it's not the type of tree that I want.

Here's my file to be built into a tree: https://drive.google.com/open?id=1QXXSJ2DJjJHz8K1WHuERFPQBTSvsWrcL

ADD COMMENTlink modified 6 months ago by h.mon29k • written 6 months ago by mac03pat10

Not affecting this issue but keep in mind that your input file: extracted_KS_with_taxa.fa, is with carriage return ^M.

ADD REPLYlink written 6 months ago by SMK1.9k
1
gravatar for h.mon
6 months ago by
h.mon29k
Brazil
h.mon29k wrote:

Trying to run muscle on a file to build a tree. I successfully used muscle to align this file in .clw format yesterday.

Please be precise when asking a question. As input, MUSCLE accepts fasta files, and as you said your file is in clustal format, initially I believed this would be the cause of the error. You say your file is in clustal format, but it is in fasta format:

>DQ660910.3 Xanthoria elegans strain gbM10 polyketide synthase type I (PKSI) mRNA, complete cds [2526:3816](+)
ATCGCTATCGTGGGAATGGCGGGAAGGTTTCCGAATGCTGCCAATCACGAGTTGTTCTGGGA
>HM180409.1 Peltigera membranacea non-reducing type I polyketide synthase (PKS6) gene, complete cds join{[1258:1268](+), [1286:1342](+), [1402:1756](+), [1812:2658](+)}
GGAATGGCTGCCGACCATTCGAAATTCTGGGATTTACTTGAGTCGGGCTTAGACGTTCATAGAAAAATCCCGAAAGATCGGTTTGACGCA

The problem is muscle -maketree expects an aligned fasta as input, with all sequences having the same length (and, if needed, dashes indicating gaps), and your input is an unaligned multi-fasta file. You need first to align the sequences.

MUSCLE builds a "quick and dirty" tree using neighbour-joining. If your intention is to build a plylogenetic tree, I suggest you use something like PHYML, RAxML or IQ-Tree.

ADD COMMENTlink modified 6 months ago • written 6 months ago by h.mon29k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1100 users visited in the last hour