Entering edit mode
6.3 years ago
snishtala03
▴
70
Hello,
I am new to processing PacBio data so please excuse me for a naive question.
I have 6 samples and 3 of them used Clontech 3' CDS Primer II A: 5’–AAGCAGTGGTATCAACGCAGAGTACT(30)N-1N–3’ and the other 3 used - project specific design: 5’–AAGCAGTGGTATCAACGCAGAGTACT(30)GWAGC -3’
When running lima from the IsoSeq3 pipeline, we need to give primers.fasta file in the form of 5p and 3p sequences. Can you help me how I can use these sequences in the 5p and 3p format?
Thanks!