primers for PacBio lima software
0
0
Entering edit mode
2.3 years ago
snishtala03 ▴ 40

Hello,

I am new to processing PacBio data so please excuse me for a naive question.

I have 6 samples and 3 of them used Clontech 3' CDS Primer II A: 5’–AAGCAGTGGTATCAACGCAGAGTACT(30)N-1N–3’ and the other 3 used - project specific design: 5’–AAGCAGTGGTATCAACGCAGAGTACT(30)GWAGC -3’

When running lima from the IsoSeq3 pipeline, we need to give primers.fasta file in the form of 5p and 3p sequences. Can you help me how I can use these sequences in the 5p and 3p format?

Thanks!

pacbio lima primer isoseq clontech • 808 views
ADD COMMENT

Login before adding your answer.

Traffic: 2484 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6