Question: primers for PacBio lima software
0
gravatar for snishtala03
5 months ago by
snishtala0330
snishtala0330 wrote:

Hello,

I am new to processing PacBio data so please excuse me for a naive question.

I have 6 samples and 3 of them used Clontech 3' CDS Primer II A: 5’–AAGCAGTGGTATCAACGCAGAGTACT(30)N-1N–3’ and the other 3 used - project specific design: 5’–AAGCAGTGGTATCAACGCAGAGTACT(30)GWAGC -3’

When running lima from the IsoSeq3 pipeline, we need to give primers.fasta file in the form of 5p and 3p sequences. Can you help me how I can use these sequences in the 5p and 3p format?

Thanks!

pacbio primer lima clontech isoseq • 220 views
ADD COMMENTlink modified 5 months ago • written 5 months ago by snishtala0330
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1603 users visited in the last hour