Question: How to generate OTU table including fasta sequences from QIIME output?
0
gravatar for arsilan324
26 days ago by
arsilan32470
arsilan32470 wrote:

Hi all, I need some help in making OTU table (excel format) which includes read abundance, taxonomy, and fasta sequences. I used QIIME to generate output and it gives me two separate files. I have tried a few methods to combine both files but it's not working for me. I am wondering if you can guide me on how can I generate such a table (maybe using biom file etc)? Here you can see the subset of both files as an example.

File 1

#OTU ID CW1.7   CW17    CW1.PW10    CW1.R10 CW119   CW1.10  taxonomy
denovo0 1   0   0   0   0   0   Unassigned
denovo1 0   4   1   1   1   0   k__Bacteria; p__Chlorobi; c__OPB56; o__; f__; g__; s__
denovo2 0   0   0   0   0   1   k__Bacteria; p__Firmicutes; c__Clostridia; o__Clostridiales; f__Lachnospiraceae; g__Coprococcus; s__
denovo3 0   0   0   0   1   0   Unassigned
denovo4 0   0   0   0   1   0   k__Bacteria; p__Proteobacteria; c__Gammaproteobacteria; o__Xanthomonadales; f__Xanthomonadaceae
denovo5 0   0   0   0   0   0   k__Bacteria; p__Bacteroidetes; c__Bacteroidia; o__Bacteroidales; f__; g__; s__
denovo6 0   1   0   0   0   0   k__Bacteria; p__Bacteroidetes; c__Bacteroidia; o__Bacteroidales; f__; g__; s__

and File 2

>denovo0 CW1.7_221275
AGCCGCGGTAATACGGAGGGTGCAAGCGTTATCCGGATTCACTGGGTTTAAAGGGTGCGTAGGTGGGTTAGTAAGTCAGTGGTGAAATCTTCGAGCTTAACTCGGAAACTGCCATTGATACTATTAGTCTTGAATATTGTGGAGGTTAGCAGAATATGTCATGTAGCGGTGAAATGCTTAGATATAACACAGAACCCCCGATTGCGAAGGCAGCTTACTGGGATACAACTGACGCTGATGCACGAAAGCGTGGGGATCAAACAGGATTAGATACCCTGGTAGTCCACGCAGTAAACGATGAATACTAACTGTTTGCGATACACAGTAAGCGGTACAGCGAAAGCGTTAAGTATTCCACCTGGGGAGTACGTTCGCAAGAATGAAACTCAAATGAATTCACAG
>denovo1 CW17_70760
CGCCGCGGTAATTCGTAGGACCCGAGCGTTGTCCGGATTCACTGGGTATAAAGGGTGCGTAGGCGGTCTTGTGCGTCAGAGGTGAAATATCCGGGCTTAACCCGGAGGGTGCCTTTGATACGGCAGGACTTGAGTCCGAGAGAGGATGATGGAATTCCTGGTGTAGCGGTGAAATGCGTAGATATCAGGAGGAACACCGGTGGCGAAGGCGGTCATCTGGCTCGGAACTGACGCTGAGGCACGAAAGCGCGGGGATCAAACAGGATTAGATACCCTGGTAGTCCGCGCCCTAAACGATGTATGCTTGGTGTTGGGCCTTTCGGGGCTCAGTGCCGTAGGGAATCTGATAAGCATACCACCTGGGGAGTACGATCGCAAGGTTG
>denovo10 CW1.R10_185008
AGCCGCGGTAATACGAAGGGGGCTAGCGTTGTTCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGATTATTAAGTCGGGGGTGAAATCCCGAGGCTCAACCTCGGAACTGCCTTCGATACTGGTAATCTTCGAGTCCGGGAGAGGTGAGTGGAACTCCGAGTGTAGAGGTGAAATTCGTAGATATTCGGAAGAACACCAGTGGCGAAGGCGGCTCACTGGCCCGGTACTGACGCTGAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGAATGCTAGTTGTTGGTAAGTTTACTTATCAGTGACGCAGTTAACACATTAAGCATTCCCGCCTGGGGAGTACGGTCGCAAGATTAAAAACTTAAAGGAATTCGCGG
>denovo100 CW232_131116
CGCCGCGGTAATTCGGAGGATGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGAGCTTAAGTCAGTGGTGAAATCTTGCAGCTTAACTGTAAAATTGCCATTGATACTGAGTTTCTTGAGTGCGGTTGAAGTAGGCGGAATGTGTAATGTAGCGGTGAAATGCTTAGAGATTACACAGAACACCGATTGCGTAGGCAGCTTACTAAGCCGTAACTGACGCTGAGGCACGAAAGTGTGGGGATCGAACAGGATTAGATACCCTGGTAGTCCACACTGTAAACGATGATCACTAGCTGTTGGCGATAAACAGTCAGCGGCAAAGCGAAAGCATTAAGTGATCCACCTGGGGAGTACGTTCGCAAGAATGAAACTCAAATGAATTCACGG

Thank you very much in advance

qiime otu table miseq mothur fasta • 125 views
ADD COMMENTlink modified 25 days ago by andres.firrincieli100 • written 26 days ago by arsilan32470
0
gravatar for andres.firrincieli
25 days ago by
andres.firrincieli100 wrote:

convert your fasta file in to a tab delimited file Question: fasta file to tab delimited file

Then use the merge() function in R to merge the fasta table with the OTU table

ADD COMMENTlink modified 25 days ago • written 25 days ago by andres.firrincieli100
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1660 users visited in the last hour