Question: Mapping Trinity assembled transcript back to reference genome with annotation
0
gravatar for jian227
14 months ago by
jian2270
jian2270 wrote:

Hi, I am new to RNA-seq, I am using Trinity genome guided assembly, and I could really use some help. I'd appreciate that a lot.

My pipeline is the following:

1) map my raw fastq data to mm10 using STAR.

2) feed trinity with the file STAR generated, using genome guided assembly

3) Trinity spit out assembled transcript like this :

>TRINITY_GG_1_c0_g1_i1 len=456 path=[0:0-455]
CTTCAGACTCAGTTTTTGCTTGTTTCAACTGTCCCGTATACACATCAACATGGTATCTCACCAATGGAAAAA
CAGGCTCTCCTTCTTTCATTACAGGAAGCTCACAGACAATGTCTCCATCAGCCTGGTTCCGAGAAAGACA
CACATTTGCAACAAAATGTAGGGTCTTCTTGCTCTTCACGTTTTCCATTGTCACCCTCTGTAAGGTCCACT
CTGGTTGCCCACCAGTTCCATCATGTCCTATTCTGATCTTGTATATCTCTCCAATGCCTCTTAGTACAACCT
GAAATTCATCTGTCTGTCCTGGAAGGAAGAGCTTTTCTTGGCTGTCCTTGGTAAGGCTGATTGGTCCAGT
GACACCTTCATATCCATACACCCACAATGTGACATTGGCCTGAGTACCTGTGTTT
CCAGTCACCACTAAGACCTTCCATTTTTCTTCTAACAGAAGTGTCT

4) Then I use gmap to map those reads back to reference genome, it gave me:

Alignments: Alignment for path 1:

+chr1:4147901-4147963  (1-63)   100% <-   ...648...  0.994, 0.859
+chr1:4148612-4148744  (64-196)   100% <-   ...15110...  0.999, 0.984
+chr1:4163855-4163941  (197-283)   100% <-   ...6263...  0.996, 0.999
+chr1:4170205-4170377  (284-456)   100%

My Question GMAP didn't give me which transcript is this, but only the genomic coordinate, my goal is to find de-novo transcript which is not presented on the reference GTF file, therefore, I hope there is some tools, which I can annotate my transcript, then whichever left (those didn't get to map to a reference transcript, I can investigate them more)

This is my first time post question here, I apologize in advance if there is anything inappropriate.

ADD COMMENTlink modified 14 months ago by h.mon31k • written 14 months ago by jian2270
3
gravatar for h.mon
14 months ago by
h.mon31k
Brazil
h.mon31k wrote:

If you have a reference annotated genome and want to discover new transcripts, then you should be using Stringtie.

ADD COMMENTlink written 14 months ago by h.mon31k

Thank you very much for your kind reply. Can I feed StringTie the transcript assembled by trinity? Or it is better use HISAT2 + StringTie?

ADD REPLYlink written 14 months ago by jian2270

I am not sure if you can feed a mapping of the Trinity transcripts to StringTie. But even if possible, I would think it is better to follow the documented workflow of mapping raw reads - I am sure StringTie can use the information of mapping depth and quality to access transcript support, and this information would be lost if you mapped the assembled Trinity transcripts.

ADD REPLYlink written 14 months ago by h.mon31k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1058 users visited in the last hour