Question: Looking for a DNA -> Protein Sample/Example.
0
gravatar for rebelCoder
12 months ago by
rebelCoder10
Riga/London/Moscow/Minneapolis
rebelCoder10 wrote:

Hello everyone!

I am looking for a real example of a DNA sequence that codes for a real (any) protein. the shorter, the better.

I have the following Fake/Randomly Generated sequence:

"AAAGAACATGACTCCAATTTCGGAACCAAGTAGTTAAATCCTGTGA"

And it has the following Fake/Not Real/Test protein sequence:

'M', 'T', 'P', 'I', 'S', 'E', 'P', 'S', 'S', '_'

'MTPISEPSS'

I need this to test some of my code, but I can't seem to find any DNA Example sequences online that code for a real protein. If anyone has an example or a way to get that from any Gene Banks, please let me know.

Regards, Juris.

dna protein sequence • 361 views
ADD COMMENTlink modified 12 months ago • written 12 months ago by rebelCoder10
1
gravatar for rebelCoder
12 months ago by
rebelCoder10
Riga/London/Moscow/Minneapolis
rebelCoder10 wrote:

I got some help from IRC, so this is no longer a problem:

Insulin DNA Sequence:

enter image description here

Protein Sequence: enter image description here

ADD COMMENTlink modified 12 months ago • written 12 months ago by rebelCoder10
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1058 users visited in the last hour