Question: Error : viGEN : bowtie2 Alignment - No input read files were valid
0
gravatar for venura
9 months ago by
venura30
venura30 wrote:

Hi,

I am using viGEN pipeline to identify viruses in RNA-Seq data. I am getting following error when I run the script.

stat: No such file or directory Warning: Could not open read file "/home/venura/viGEN-master/unmapped_fastq/RRV4_un/RRV4_un__1.fq" for reading; skipping... Error: No input read files were valid (ERR): bowtie2-align exited with value 1

As one other post suggested I looked whether it has to something to do with the path using head -4 /home/venura/viGEN-master/unmapped_fastq/RRV4_un/RRV4_un_1.fq It reads the first four lines of the .fq file without any problem.

@V300020467L4C001R0020000146 GAAGAAGTTAACATCTTTAAGGATGATGTTGTTATTCAGTTCATCAACCCTAAGGTTCAAGCTTCAATTGCTGCAAACACATGGGTTGTTAGCGAAGTCG + eefeeeeeeeeeeeeeeefeeeeeeeeeeeeeeeeeeeeeeedeeeee_fedefeeefeeeefeefeffdfefffefffffffeeeefcfeeeeeecfef

Can some one help me to troubleshoot the error? Thank you!

Complete script is given below( I removed the functionFlagstatBam given in the original script since authors forgot to include the function in the script uploaded there at github. I opened an issue there requesting author to include the missing function.)

#!/bin/bash

# Alignment using Bowtie2
functionBowtie2() {
    echo "Start - Align using Bowtie2 local algin" >> $LOG
    $BOWTIE2_SW"bowtie2" -x $BOWTIE2_REF --local -1 $I_FOLDER$ID"_1.fq" -2 $I_FOLDER$ID"_2.fq" --threads $N_THREAD --al $O_FOLDER$ID/$ID".bowtie2.align" --un $O_FOLDER$ID/$ID".Bowtie2.unaligned" -S $O_FOLDER$ID/$ID".bowtie2.sam" --sensitive > $O_FOLDER$ID/$ERR2 2> $O_FOLDER$ID/$ERR3
    echo "End - Align using Bowtie2 local algin" >> $LOG
}

#Convert SAM file to BAM file
functionConvertSamtoBam() {
    echo "Start - convert sam to bam file using Samtools" >> $LOG
    $SAMTOOLS"samtools" view -bS $O_FOLDER$ID/$ID".bowtie2.sam" > $O_FOLDER$ID/$ID".bowtie2.bam"
    echo "End - convert sam to bam file using Samtools" >> $LOG
}

#Sort BAM coordinate wise
functionSortBam() {
    echo "Start - Samtools sort bam file" >> $LOG
    $SAMTOOLS"samtools" sort $O_FOLDER$ID/$ID".bowtie2.bam" -o $O_FOLDER$ID/$ID".bowtie2.sorted.bam" -@ $N_THREAD
    echo "End - Samtools sort bam file" >> $LOG
} 

#Index BAM file
functionIndexBam() {
    echo "Start - Samtools index bam file" >> $LOG
    $SAMTOOLS"samtools" index $O_FOLDER$ID/$ID".bowtie2.sorted.bam"
    echo "End - Samtools index bam file" >> $LOG
}

# Samtools idx -  genome level counts
functionIdxStatsBam() {
    echo "Start - Samtools Idx" >> $LOG
    $SAMTOOLS"samtools" idxstats $O_FOLDER$ID/$ID".bowtie2.sorted.bam" > $O_FOLDER$ID/$ID".bowtie2.idxstats.txt"
    echo "End - Samtools Idx" >> $LOG
 }

########################################
# Values to set by the user
N_THREAD=8
I_FOLDER="/home/venura/viGEN-master/unmapped_fastq/RRV4_un/"
O_FOLDER="/home/venura/viGEN-master/output_bowtie2/"

LOG=$O_FOLDER"/pipeline_log.txt"
ERR2="system.err.bowtie2.txt"
ERR3="log.bowtie2.txt"
SAMTOOLS="/usr/bin/"
BOWTIE2_SW="/usr/bin/"
BOWTIE2_REF="/home/venura/viGEN-master/vir_ref/virus.bowtie2.refB"

for x in $(cat samplenames.txt)
do
    echo $x
    ID=${x%*}

    echo "-----------------------------" >> $LOG
    echo $ID >> $LOG

    START=$(date +%s) 

    mkdir $O_FOLDER$ID

    functionBowtie2

    functionConvertSamtoBam

    functionSortBam

    functionIndexBam

    functionIdxStatsBam

    END=$(date +%s)
    DIFF=$(( ($END - $START)/60 )) 
    echo "It took $DIFF minutes" >> $LOG
done
rna-seq allignnment bowtie2 • 217 views
ADD COMMENTlink modified 9 months ago • written 9 months ago by venura30
1

The file from the error message ( RRV4_un__1.fq ) has a double underscore in its name; the file from the head command ( RRV4_un_1.fq ) doesn't: un__1.fq vs un_1.fq.

ADD REPLYlink written 9 months ago by h.mon30k

Thank you! I screwed up the samplenames.txt where I added underscore. :(

ADD REPLYlink written 9 months ago by venura30
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1580 users visited in the last hour