Question: Can some one help me find the locus tags of this strain of DNA
0
gravatar for Loki375
25 days ago by
Loki3750
Loki3750 wrote:

This is the strain it comes from I would like to know the locus tags of this so far I have CT610 and CT613 but there are more can some one help me find the other ones? Chlamydia trachomatis strain D/UW-3/Cx

GGGCTGACAGAAGCTGTCAGATCATTTTAATAAGATTGATGACAACTACA
ACAAGTTCCTGGATCCAAAAAAGAATCTAAAAAGCCATACAAAGATTGCG
TTACTTCTTGCGATGCCTCTAACACTTTATCAGCGTCATCTTTGAGAAGC
ATCTCAATGAGCGCTTTTTCTTCTCTAGCATGCCGCACATCCGCTTCTTC
ATGTTCTGTGAAATATGCATAGTCTTCAGGATTGGAAAATCCAAAGTACT
CAGTCAATCCACGAATTTTCTCTCTAGCGATACGTGGAATTTGACTCTCA
TAAGAATACAAAGCAGCCACTCCTGCAGCTAAAGAATCTCCTGTACACCA
CCGCATGAAAGTAGCTACTTTCGCTTTTGCTGCTTCACTAGGCTCATGAG
CCTCTAACTCTTCTGGAGTAACTCCTAGAGCAAACACAAACTGCTTCCAC
AAATCAATATGATTAGGGTAACCGTTCTCTTCATCCATCAAGTTATCTAA
CAATAACTTACGCGCCTCTAAATCATCGCAACGACTATGAATCGCAGATA
AATATTTAGGAAAGGCTTTGATATGTAAATAATAGTCTTTGGCATACGCC
TGTAATTGCTCTTTAGTAAGCTCCCCCTTCGACCATTTCACATAAAATGT
GTGTTCTAGCATATGCTTATTTTGAATAATTAAATCTAACTGATCTAAAA
AATTCATAAACACCTCCATCATTTCTTTTCTTGACTCCACGTAACCGCTT
GCAAAAAAGGTCCGTATAAGTCCTCTGTTTCATCTATGCGCAAAGAACAA
TACTCTTCTCGAGAAGTAGGATGTGAATGGTAGACCATATTAGGTGCCTG
CTCTATCACCGCTAACGGTGTTTGCTCATTCCCCTCTCCCATACAAACAA
CAGCCGCAACTGCTAAGGCATCTACAAGATTACTTTGCGTCATCTGTAAG
GGACGACCGAAACAATCTAGCGATCCTATATAGTTGTGTAATGGAGAAAA
TCCATACCAACACAGCCCGATACCCAGTACTCCACGCCGCATTGGAGTAG
TATGGCTATCTGTAATGATTACGCCTAGCTCTTTCACTCGAAAATAATTT
CTTAACCATTCTCCGATGCGATTACACGATCCCAAAATATCTTTAGGATA
TAAAACAAAAGGCTGGTCCGTATTCGATTCATCAATCCCTGCAGAAGGAA
TCAAAATACCTTCTTTTTTCGTTAGATATATCCCGCTTTTCTCACAAAAC
AAATAAGCATCCGCTTCTTTTTTTATCAGCTCTGCTTTGCACATTCTTGC
ATCAGCGACAGCGCCTTCACATAAACTCACAATCTTTGAAGAGACAACTA
CCACACTCCGTTCTTGCAGAGGCGGCAAAGCCTCTTGCAAGATCTCTTGA
AGCGAATCATGTGCAAATACTTTACGTGTTTTGATCGGAGTTATTTTCAT
AATAATAAATACTGAAATCCTCTGTATTACAAATACATTCCTTCTTCCAT
CCTGATAATCGCGTGATAGGGAAGAAAGTATCGCCCCAATATTCCTTTTT
GATATGTGTGACAAAACAAGCTTTCAGAAGGTTTTGTTGGAAAAAACTTT
CAAAGAGCTCCGCTCCCCCAATTAAAAACGGATGATTCAAAGATAGTGTC
CCATACTCTGCAAAGGAAGAAACTCCTATGCATTGTGGTGGATGCATCCT
GCGAGAAAAGACAACGATATCCCGCCCATGCTTATACTTGTCTGGAAGAG
ACTCCCAAGTCTTTCGTCCCATAATGATGGGATGATTTCGAATGGTTTCT
GCAAAAAAACGTAGATCTTCGGGATAACTCCAAGGGAGCTTGCCTAAAGC
TCCCATCACTCCTCTGGGATCAATAGCAACGATACCTGTTGCTTGGATCA
TACAAACATACCAGCCCAAGCAGCAGCGGCTAAGGCACGTCTGTTACCTT
CAACCTGATGCACGCGTAGATAATCAACTCCTCGATCATGAAGAGATACA
GAACAGCCGATCGTTTCCCAATCACGATCGTTACTATTAAATCGGCCCAA
CATACTCAAACACGATTTTCTAGAATGGCCTATTAATACAGGACACTCTA
AAACACGTTTAAACTGCTTTACTCCATCCATCAATAACATCGACTGAACG
GGAGTCTTCCCAAATCCTATTCCTGGATCGAAAACAACTTGCCAACTTGT
ATCTAAACCTACTTGAGCAAATTGTTCTAACTGAGACTCTCCCCAACGCA
ACATTTGCTCAATAGGAGATTCTTCATAAGAAAGTACACAATCTGGTCTT
GGAGGCAGCGAACACGAATGATTTATTAATAGCCGTAGCCCAAACTCCTT
CGCCAAATGAGCCATTTCCAAAGAGCCTCCAGAAACATCATTGATCCAAC
GAATCGGAAATACTTCAACAGCTCGTCGAATAATCTCTGGACGAAATGTA
TCGATAGATACATCAGGGCATTGTTGAGCAGCCCCCCACCGCTCCGCTAA
TAAACGCAAAACAGGTTCTAGACGCTCCCACTCTTGTTCTACGCTTCCTA
AATCTTTTACACGAGGATTGGTTGCTTGCGCCCCTAAATCAATAATAGAA
GCTCCTTCTGCAAAGAGTCTCTCAGCATGGGCTGCGGCTCTTCTCGCCTC
CAGAAACAATCCTGTATCGGAGATCGAGTTATCCGTAATATTAACAATAC
CCATAATTTGGGTAGCAGAACCGAAACTGCCTAACGCATCCTCCTCCGTC
AATGGATAAATAGCAGCAAGCTCTGCAAACGTTTTCCCATTACAAGAAGA
TCCTTCCAAACGGAAACGACGATACGGACATAAAGAAGCTATCATAGAAA
GAAGAAAAGGTCTTTCTAATACCTTAGGATGTGGGATTGTACATTTGTCA
CTATGATAAGAAAAAGCTTCGTCTCCATAGAAAAGCACATCAATATCAAT
CGGTCGAGGCCCCCATTTCAAAGAAGCATCTTGTCCAAAACGACTTTCTA
TCATCTTGATTTCTTCAATCAACTCGTCTGGAGATAGCTGCGTTTCCCCA
ATAACCACAGAGTTAAAATAAGGAAGATCCCATTCTTTCGGAGCCCCTTC
TAACAACAAAGCCTTCGTCTCTAAAATCACAGAACTTTTTAAATTTCGGA
TCCCAGCCTTCTTTAAACTTGCATAAGCGCGTCTTATATGCTCATGCCGG
TTACCTAAATTGGAACCCAAACTTAAACAAACAAAATTCCAACTAGTCAT
GGCACCTCTCTACTTATGCTGAAACTTACAGGACTGAGTAGATCTGGGAT
C
sequence • 115 views
ADD COMMENTlink modified 24 days ago • written 25 days ago by Loki3750
1

Data for RefSeq sequence for Chlamydia trachomatis strain D/UW-3/Cx.
Using EntrezDirect. Output truncated. Parse things you need from this.

$ efetch -db nuccore -id "NC_000117" -format ft | head -20
>Feature ref|NC_000117.1|
1041920 1042519 gene
1       1176
                        locus_tag       CT_875
                        db_xref GeneID:884145
1041920 1042519 CDS
1       1176
                        product hypothetical protein
                        transl_table    11
                        protein_id      ref|NP_219502.1|
1593    1321    gene
                        locus_tag       CT_001
                        db_xref GeneID:884027
1593    1321    CDS
                        product hypothetical protein
                        transl_table    11
                        protein_id      ref|NP_219503.1|
1794    2096    gene
                        gene    gatC
                        locus_tag       CT_002
ADD REPLYlink modified 25 days ago • written 25 days ago by genomax75k

I saw those but It kept telling me it was incorrect.

ADD REPLYlink written 24 days ago by Loki3750

How many coding sequences is this?

ADD REPLYlink written 24 days ago by Loki3750
1

Are you only interested in the piece of sequence you posted in the original question? Solution I showed above will get you locus_tag for entire genome.

You could simply blast the sequence (if that is all you are interested in) against NC_000117 and get the info you need.

ADD REPLYlink written 24 days ago by genomax75k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 982 users visited in the last hour