How to convert a text file into gtf file?
1
0
Entering edit mode
2.3 years ago

I am facing a problem while running feature counts as my input reference file is in text format. I would like to know a way to convert this file into gtf.

>hsa_piR_000001|gb|DQ569913|Homo sapiens:21:43519790:43519815:Plus
AAACAAACCUGACUUUGUGGGGGCGC
>hsa_piR_000002|gb|DQ569914|Homo sapiens:15:49361981:49362009:Minus
AAACAAAGAAACAGGUGGUGAGAAUGUGU
>hsa_piR_000003|gb|DQ569915|Homo sapiens:19:39999145:39999173:Minus
AAACAGAUGUGCUCAAGCUGAGUGGUCCA
>hsa_piR_000004|gb|DQ569917|Homo sapiens:2:231979486:231979511:Minus
AAACAGUGGUUACAGGGGGCUCAGAU
>hsa_piR_000005|gb|DQ569918|Homo sapiens:3:199288152:199288178:Minus
AAACAUUGAGGAUGUCUACGGCAACAC
>hsa_piR_000006|gb|DQ569921|Homo sapiens:11:13587875:13587903:Plus
AAACCGAAUAAAGUCUUCAUCUGAUGCUC
>hsa_piR_000007|gb|DQ569922|Homo sapiens:12:131188624:131188651:Minus
AAACCUACAUCCACACAGAAACGUACAC
>hsa_piR_000008|gb|DQ569923|Homo sapiens:17:362636:362661:Plus
AAACGAGGUAAUGAUCCUGGAGCCUA

This is the input text file.

Thank you in advance

RNA-Seq • 1.1k views
ADD COMMENT
1
Entering edit mode

A little bit more info would be appreciated, but maybe you can do it re-ordering the columns. See more abour the GTF format Here

ADD REPLY

Login before adding your answer.

Traffic: 704 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6