Question: How to convert a text file into gtf file?
0
gravatar for geethapriyanka7
12 months ago by
geethapriyanka70 wrote:

I am facing a problem while running feature counts as my input reference file is in text format. I would like to know a way to convert this file into gtf.

>hsa_piR_000001|gb|DQ569913|Homo sapiens:21:43519790:43519815:Plus
AAACAAACCUGACUUUGUGGGGGCGC
>hsa_piR_000002|gb|DQ569914|Homo sapiens:15:49361981:49362009:Minus
AAACAAAGAAACAGGUGGUGAGAAUGUGU
>hsa_piR_000003|gb|DQ569915|Homo sapiens:19:39999145:39999173:Minus
AAACAGAUGUGCUCAAGCUGAGUGGUCCA
>hsa_piR_000004|gb|DQ569917|Homo sapiens:2:231979486:231979511:Minus
AAACAGUGGUUACAGGGGGCUCAGAU
>hsa_piR_000005|gb|DQ569918|Homo sapiens:3:199288152:199288178:Minus
AAACAUUGAGGAUGUCUACGGCAACAC
>hsa_piR_000006|gb|DQ569921|Homo sapiens:11:13587875:13587903:Plus
AAACCGAAUAAAGUCUUCAUCUGAUGCUC
>hsa_piR_000007|gb|DQ569922|Homo sapiens:12:131188624:131188651:Minus
AAACCUACAUCCACACAGAAACGUACAC
>hsa_piR_000008|gb|DQ569923|Homo sapiens:17:362636:362661:Plus
AAACGAGGUAAUGAUCCUGGAGCCUA

This is the input text file.

Thank you in advance

rna-seq • 387 views
ADD COMMENTlink modified 12 months ago by GenoMax96k • written 12 months ago by geethapriyanka70
1

A little bit more info would be appreciated, but maybe you can do it re-ordering the columns. See more abour the GTF format Here

ADD REPLYlink written 12 months ago by biofalconch470
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 991 users visited in the last hour
_