How to view MUSCLE ouput
1
0
Entering edit mode
21 months ago
tw617 ▴ 40

I did a multi-sequence alignment with MUSCLE and used -html to output a fasta file. When I use ctrl+O to view the file in my brower, it is just bland html code (it appears it shows up properly in this comment box):

KP223131.1 GATTTAAGTGAATAGCTTGGCTATCTCACTTCCCCTCGTTCTCTTGCAGAACTTTGATTT

The file is quite large and was rejected by all of the MSA viewers... I think this is because its in html format. What is a good way to visualize this data and why is showing up colored in this comment and not in my browser?

muscle MSA data visualization • 383 views
ADD COMMENT
2
Entering edit mode
21 months ago
Mensur Dlakic ★ 15k

There are bunch of output formats supported by MUSCLE, and HTML is probably the only one not supported by MSA viewers. All others (aligned fasta, which is default; MSF; CLUSTALW) should be viewable without any problem. Just about any MSA viewer will do a good job coloring the alignment - I like Jalview.

ADD COMMENT
0
Entering edit mode

Thanks! I will re-run the analysis without the -html flag. Sadly it takes about 1.5 hrs :(. Does the html file have any use?

ADD REPLY

Login before adding your answer.

Traffic: 2149 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6