Question: lncRNA prediction using CPAT?
0
gravatar for mathavanbioinfo
8 months ago by
India
mathavanbioinfo50 wrote:

Hello All, I am trying to find the lncRNA using the CPAT, the following error I got Command used python3 cpat.py -g SRR58075_uix_orf.fa.tar.gz -d Human_logitModel.RData -x Human_Hexamer.tsv -o out.txt

Error message Traceback (most recent call last): File "cpat.py", line 241, in <module> main() File "cpat.py", line 229, in main print >>sys.stderr, "Input gene file is in FASTA format" TypeError: unsupported operand type(s) for >>: 'builtin_function_or_method' and '_io.TextIOWrapper'. Did you mean "print(<message>, file=<output_stream>)"?

Sample fasta file

MSTRG.32.1 GTGTAGTAGTGCTATCGCAGCTGACTGCAGCCTCAACCTTCCAGGCTGAAGCGATCCTCCCACCTCAACCTCCCACGTGGCTGAGACTACAGGTGCTTGCCACTATGCCCAACTAATATTTGGAATTTTCGTATACGTGGATTCCAGAGGGGTGACAGCAAAACGTGAGTAAGCATGGATTTTGGTATATGCAGAGATGGGGGGCTGGAACTAATTCTGTATACTGAGGGACGACGACTGTATATGTTTTTACAATTACGCTGTAGGATACATACTGTTGCATAGCCTTGAAAATAATAATTTTTAATTGAGTGGAATAAGAATAATATTGATAAAAGTAGCAGCTGGCCAGGTGTGGTGGCTCACACTGGTAATCACAACACTTTGGGAGGCTGAGGCAGGAGGATGGCTCGAGGCCAAGAGTTTGCGATAGGCCTTGGAAACAAAGGGGGAGTCACCATCCCTACAGAAAAATACATGAATTAGCCTAGTGTGGTGGCATGTTCCTGTAGTCCCAGCTACTTGGGAGGCTGAGGTGGGAGGATCACTTGAGCCCAGGGAGGCTGAGACTGCAGTGAGTCATGATCAGGCCTCTGCACTCCAGCCTGGGTGACAGAGTGAGACCCTGTCTCAAAACAACAAAAAAGTAGCAGCCAACATCAACTGACCTTTTGTACCAGGTGCCTATTGATACCATAGTTTAATTTCTTATAACTGTTTCTTATTTCACTTACCAACTCTGTCTTCAGTTACTCCCAGATTTTTACTGTGTGTGTACAGATGACCTTTTGTTTAGACTGAATTGTCTCCCCAGAAGTAAGATTACTGTGAGTCATGGTGAATGGACATTCTCCTTACCCTTGATGTAAATTGACAGGGTTTTGGGTGCCTCCCAGCTATAATCTTAGCACTTTGGGAGGCTAAGAGAGGAGGATTGCTTGAGGCCAAGAGTTGGAGGAGGCAGTATGGCAGTATGGTGAGACCCTGTCTCCATTATTTTAAAAAATTGACAGGCTTTACCCTGGAAGGCTTATACACAATTTAACCACCCCTCATAGTATAAGAAAGTGCCCATTTCACTGCACCTTTGCCAGCACAGGGTATTATAATTTAGTAAGTCATTTTTTGTTTGATTATTTTACATAGACAAAAGAACTCATATTACTTTACTTGTCACATTTCAACATCTTTCCTCAGCTTATTAGCTCTATTTCTTTTCTGTCTGTAAATGGTTGTTGCTGTTTTGGTCTTTGAGACAGGATCTTGCTCTGTCACCAGGCTGGACTGTAGTGGCATAATCATGCCTCACTGCAGCCTTGACCTCCCAGGCTCAAACTTCAGCATTCCGAGTAGCTGGGACTACAAGTGTGCACCACCACCCCCAGCTAACTTTTTTCTTCTTTTGGATAGAGACAGGGTCTCACTGTGTCGTCCAGACCGGTCTCTAGCTCCTGGCCTTAAGCAATCCTCCTGCATTAGCTTCTGAAATTACTGGAATTTCAGGCATGAGCCACCATGCCTGGCCTGGGCTAGTCCCATATTCTCTAGAGTTCTGTTTACTTTGTGCTAGCCAATCTCTCATTATGCTGTTCACCTGTTATAATGAATAATTCTCTGTATTAAATTTTACCACTTTAAACTTTTGAGTGGTTTATGCTTCCTGATTGGACTCTGACTAATATGTTAGGAAGGGTCCCAGGAGGTAGACCCACACAGATGGGATTTGGGCATAGGTTTGGTTTCCCAGGGGGCAGTGCTGAGCTCTTTGCCAGTGGGAAATGGGATGCTGGTGATTTCCAGTAGGTGACCTCACAGTGACTCAAGCTACCACTTACTGTTGATTGTGACGAAATGCCAGCTGAGGCACATGCCTTGGGAGCTAAGTGGTTGCTGCCCTTGACCACTGTGAAGACTGGTGTGGGAAGGGTCGCTTTGGATGCACTTGAGCAGGGGTCCCCAACCCCTGAGCCATGGAGCCGCAAGGAGCCACACAGCAGGAGGTGAGCGGTGTCGAGTGAGGGAGTGAGGGAAGCTTCGTCTGTATTTACAGCCACTCCCCTTTGCTCACATTCCCGCCTGAGCTCCACCTTCTCAGATGAGCAGCAGCGTTAGATTCTCATAGGAGAACGCACCCTGTTGTGAACCGTGCATGTGAGGGATCAAGGTTGCGCTGTCCTTATGAGAATCTAATACCTATTGATCTGTTACTTTCTCCCATCACGCTCAGGTGGGAACATCCAGTTGCAGGAAAACAAGCTTAACACGCCCACTGATTCTAC Plese share your ideas to solve this isssue

lncrna cpat • 235 views
ADD COMMENTlink modified 8 months ago • written 8 months ago by mathavanbioinfo50
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1847 users visited in the last hour