STAR multiple mapping
1
0
Entering edit mode
12 months ago

Hello Everyone.

I am running STAR aligner for a single small read. The read details are mentioned below. I am not understanding the reason behind this mapping. I expected maximum of 2 mismatches in alignment as per my command. I would appreciate if the experts could provide me with an explanation.

Command used:

STAR --genomeDir referencegenome --runThreadN 16 --readFilesIn testE1.fastq --genomeLoad LoadAndKeep --outFilterMismatchNmax 2 --limitBAMsortRAM 75000000000 --sjdbOverhang 100 --outFileNamePrefix OutfileE1 --outSAMunmapped Within --outSAMattributes Standard

SAM output:

GGGTTCCAGGAGACCCGGGTTCGTTCCCGGCATCGGAG  16  5   9815402 0   15M1D18M1S  *   0   0   CTCCGATGCCGGGAACGAACCCGGGTCTCCTGGA
GGGTTCCAGGAGACCCGGGTTCGTTCCCGGCATCGGAG  272 5   18542980    0   15M1D18M1S  *   0   0   CTCCGATGCCGGGAACGAACCCGGGTCTCCTGGA
GGGTTCCAGGAGACCCGGGTTCGTTCCCGGCATCGGAG  272 5   26653270    0   15M1D18M1S  *   0   0   CTCCGATGCCGGGAACGAACCCGGGTCTCCTGGA
GGGTTCCAGGAGACCCGGGTTCGTTCCCGGCATCGGAG  272 4   17500807    0   15M1D18M1S  *   0   0   CTCCGATGCCGGGAACGAACCCGGGTCTCCTGGA
GGGTTCCAGGAGACCCGGGTTCGTTCCCGGCATCGGAG  256 1   2939455 0   1S18M1D15M  *   0   0   TCCAGGAGACCCGGGTTCGTTCCCGGCATCGGAG
GGGTTCCAGGAGACCCGGGTTCGTTCCCGGCATCGGAG  272 1   6995282 0   15M1D18M1S  *   0   0   CTCCGATGCCGGGAACGAACCCGGGTCTCCTGGA

Kindly let me know if you need any further details.

Thanks and regards,

Niranjan

alignment rna-seq • 311 views
ADD COMMENT
1
Entering edit mode
12 months ago
swbarnes2 9.8k

Looks like two mismatches to me, a one base deletion in the middle, and one base soft clipped at the end.

ADD COMMENT
0
Entering edit mode

Could you please explain how it is 2 mismatches? May be what I am assuming about mismatches is very incorrect. Something like this would really help.

        GGG TTCCAGG A G ACCCGGGTTCGTTCCCGGCATCGGAG
    CTCC  GATGCCGGGAACGAACCCGGGT C T CC     T GGA
ADD REPLY

Login before adding your answer.

Traffic: 1031 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6