how to run CD-Search with python or biopython
0
0
Entering edit mode
12 months ago
jun • 0

I'm now using the Biopython Entrez method to handle a great deal of sequencing. But I'm now facing a new problem,that is predicting the conserved domain in the sequence ( my sequences are DNA sequence.) I know this website: https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi . But I'd like to know how could I handle this website with python or Biopython?

Biopython • 367 views
ADD COMMENT
0
Entering edit mode

You can use a module called Selenium in Python to access CD Search. From there, it is just a way to find the elements that you want.

For example, you can do a little search for a especific sequence with the following script:

from selenium import webdriver
from selenium.webdriver.common.keys import Keys

# make sure to download the chromedriver.exe and put in a known location
driver = webdriver.Chrome(
    executable_path="C:/Program Files (x86)/chromedriver.exe")
driver.get("https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi")


# this textarea correspond to the box where you past the desired sequence
textarea = driver.find_elements_by_tag_name('textarea')[0]


# this command send the sequence you want to search
textarea.send_keys("CTCTAGAAACATGACATAGGGTCCACA")
# the button variable searchs for the submit button
button = driver.find_element_by_id('sbmt_newsearch')
button.click()
ADD REPLY

Login before adding your answer.

Traffic: 2293 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6