how to run CD-Search with python or biopython

Question

[jun]

I'm now using the Biopython Entrez method to handle a great deal of sequencing. But I'm now facing a new problem,that is predicting the conserved domain in the sequence ( my sequences are DNA sequence.) I know this website: https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi . But I'd like to know how could I handle this website with python or Biopython?

[johnny.sf]

You can use a module called Selenium in Python to access CD Search. From there, it is just a way to find the elements that you want.

For example, you can do a little search for a especific sequence with the following script:

from selenium import webdriver
from selenium.webdriver.common.keys import Keys

# make sure to download the chromedriver.exe and put in a known location
driver = webdriver.Chrome(
    executable_path="C:/Program Files (x86)/chromedriver.exe")
driver.get("https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi")


# this textarea correspond to the box where you past the desired sequence
textarea = driver.find_elements_by_tag_name('textarea')[0]


# this command send the sequence you want to search
textarea.send_keys("CTCTAGAAACATGACATAGGGTCCACA")
# the button variable searchs for the submit button
button = driver.find_element_by_id('sbmt_newsearch')
button.click()