BLAST Database creation error: is not a valid local ID

Question

[tianshenbio]

I tried to create blast database for my fasta file:

>ban-mir-276
agcgagguauagaguuccuacguaauacaugccuguaggaacuucauaccgugcucu
>ban-mir-9a
ucuuugguuaucuagcuguaugaguacucagacaucauaaagcuagguuaccggaguua
>ban-bantam
cugguuuucauaaugauuugacagauuguuccauauucugagaucauugugaaagcugau
>ban-mir-279b
aagggguuuaaaucuaguagcacaguguucaccugugacuagaucuacacucauuga

using command:

makeblastdb -in hairpin_name.fa -dbtype nucl -out hairpin_name -parse_seqids

An error message pops up:

Building a new DB, current time: 05/15/2020 20:26:49
New DB name:   /media/nus/AMLab_Ext1/Shen/miR_anno/rm_redundancy/hairpin_name
New DB title:  hairpin_name.fa
Sequence type: Nucleotide
Keep MBits: T
Maximum file size: 1000000000B

No volumes were created.

BLAST Database creation error: 'ban-mir-276' is not a valid local ID

Answer 1

[GenoMax]

When I copy paste your example above I see an extra ? in >?ban-mir-276. If I take that out database builds fine.

>?ban-mir-276
agcgagguauagaguuccuacguaauacaugccuguaggaacuucauaccgugcucu

[tianshenbio]

Em...But there is no such ? in my original file

[GenoMax]

Perhaps there is a character that is not visible. Edit that line and type it in and see if that fixes things.

[tianshenbio]

Thank you so much. The problem is solved. Not sure how the invisible thing is introduced...