Entering edit mode
5.4 years ago
brtawe
•
0
I have a big list of gRNA sequences and I need to retrieve the genome coordinates in a BED format in order to design primers for an rhAmpSeq experiment.
example input (as FASTA)
>seq1
GCACGAAGCTCTCCGATGTGT
>seq2
CAGTGGCGAGAGAAGACCCCG
desired output (where / is tab separated)
chrom / ChromStart / ChromEnd / Name
chr13 / 241852864 / 241852884 / seq1
In order of preference, R script, Python, online tool.
thanks in advance!
BLAT worked pretty well, the output format was slightly challenging to convert to CSV However, the main problem is the 25 sequence limit, I have >700 gRNAs and don't really want to run BLAT 28 times...
But it is better than running NCBI nBlast.
Thanks!
run the standalone version of blat....