BED coordinates for short DNA sequences (gRNA)

Question

[brtawe]

I have a big list of gRNA sequences and I need to retrieve the genome coordinates in a BED format in order to design primers for an rhAmpSeq experiment.

example input (as FASTA)

>seq1

GCACGAAGCTCTCCGATGTGT

>seq2

CAGTGGCGAGAGAAGACCCCG

desired output (where / is tab separated)

chrom / ChromStart / ChromEnd / Name

chr13 / 241852864 / 241852884 / seq1

In order of preference, R script, Python, online tool.

thanks in advance!

Answer 1

[Pierre Lindenbaum]

https://genome.ucsc.edu/cgi-bin/hgBlat

[brtawe]

BLAT worked pretty well, the output format was slightly challenging to convert to CSV However, the main problem is the 25 sequence limit, I have >700 gRNAs and don't really want to run BLAT 28 times...

But it is better than running NCBI nBlast.

Thanks!

[Pierre Lindenbaum]

I have >700 gRNAs and don't really want to run BLAT 28 times

run the standalone version of blat....