Question: How to extract reads on positive strand for a specific region from bam?
0
gravatar for venkat
6 weeks ago by
venkat0
venkat0 wrote:

Dear All,

I have paired-end RNAseq data that were aligned to hg38 genome using hisat2 with strand-specific information --dta --rna-strandness RF option.

I have lncRNA transcript which is on a positive-strand and the start and end positions are 9:115046349-115047199. I have the bam files and wanted to extract reads on the positive strand for that specific region with +/- 5kb of that region.

I tried with samtools:

samtools view -F 16 -b sample.sorted.bam “9:115041349-115052199" > sample_specificregion.bam

I see that -F discard the reads mapping on the negative strand with the flag 16.

But I see the reads in sample_specificregion.bam were showing - strand

Is this flag -F 16 right way to get reads on the positive strand for that specific region?

D00535:34:CBMGRANXX:5:2109:12145:31393  99  9   115052134   60  92M =   115052157   120 AGAGGAAAATTCTGTCATTTTCAACAACACGGATGAACCCAGAAGACATTGTACAGAGTGAAATAATCGAGGCACAGAAAGACAAATACTGC    GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG    AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:92 YS:i:0  YT:Z:CP XS:A:-  NH:i:1
D00535:34:CBMGRANXX:5:2103:4351:30673   99  9   115052135   60  93M =   115052143   106 GAGGAAAATTCTGTCATTTTCAACAACACGGATGAACCCAGAAGACATTGTACAGAGTGGAATAATCGAGGCACAGAAAGACAAATACTGCGT   FBGGFGGBGGGGGGGGGGGEGGGGGGGGGGGCGGGGGGGGGGGGGGGGGEGGGGGGG<1FFGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGG   AS:i:-5 XN:i:0  XM:i:1  XO:i:0  XG:i:0  NM:i:1  MD:Z:59A33YS:i:-5   YT:Z:CP XS:A:-  NH:i:1
D00535:34:CBMGRANXX:6:2110:18471:54222  99  9   115052135   60  93M =   115052316   278 GAGGAAAATTCTGTCATTTTCAACAACACGGATGAACCCAGAAGACATTGTACAGAGTGAAATAATCGAGGCACAGAAAGACAAATACTGCGT   GGGGGGGGGGGGGGGGGGGGGGGGGGGGBGGGGGGGGGGGFGGGGGGGGGGGGGGFGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGG   AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:93 YS:i:0  YT:Z:CP XS:A:-  NH:i:1
D00535:34:CBMGRANXX:6:2107:12093:34963  97  9   115052135   60  89M =   115052133   -94 GAGGAAAATTCTGTCATTTTCAACAACACGGATGAACCCAGAAGACATTGTACAGAGTGAAATAATCGAGGCACAGAAAGACAAATACT   GFGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG   AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:89 YS:i:0  YT:Z:DP XS:A:-  NH:i:1
D00535:34:CBMGRANXX:6:1301:21091:74975  99  9   115052135   60  93M =   115052143   106 GAGGAAAATTCTGTCATTTTCAACAACACGGATGAACCCAGAAGACATTGTACAGAGTGAAATAATCGAGGCACAGAAAGACAAATACTGCGT   FGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGFGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGG   AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:93 YS:i:-4 YT:Z:CP XS:A:-  NH:i:1
D00535:34:CBMGRANXX:6:1111:8020:42383   99  9   115052136   60  93M =   115052222   184 AGGAAAATTCTGTCATTTTCAACAACACGGATGAACCCAGAAGACATTGTACAGAGTGAAATAATCGAGGCACAGAAAGACAAATACTGCGTG   GGGGGGGGGGGGGGGGFGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGGGGGGGGGGGCGGGG   AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:93 YS:i:0  YT:Z:CP XS:A:-  NH:i:1
D00535:34:CBMGRANXX:5:1109:7064:82839   99  9   115052152   60  92M =   115052152   98  TTTCAACAACACGGATGAACCCAGAAGACATTGTACAGAGTGAAATAATCGAGGCACAGAAAGACAAATACTGCGTGATCTCATTTGTGTAA    GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG    AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:92 YS:i:0  YT:Z:CP XS:A:-  NH:i:1
D00535:34:CBMGRANXX:5:1307:7118:29073   65  9   115052181   60  91M2S   1   66292253    0   ATTGTACAGAGTGAAATAATCGAGGCACAGAAAGACAAATACTGCGTGATCTCATTTGTGTAATCTAAGAAAGCTGAACACATAGAAGCACTC   GGGGGGGGGGGGGGFGGGEGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG   AS:i:-2 XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:91 YS:i:0  YT:Z:DP XS:A:-  NH:i:1
D00535:34:CBMGRANXX:6:2315:7732:93870   99  9   115052182   60  92M =   115052270   186 TTGTACAGAGTGAAATAATCGAGGCACAGAAAGACAAATACTGCGTGATCTCATTTGTGTAATCTAAGAAAGCTGAACACATAGAAGCACAG    GGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGFGGGGGGFGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGEGGGGGG    AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:92 YS:i:0  YT:Z:CP XS:A:-  NH:i:1
counts strand rna-seq samtools • 141 views
ADD COMMENTlink written 6 weeks ago by venkat0

Refer to Samtools View: Only Forward Or Reverse Strand

ADD REPLYlink written 6 weeks ago by cpad011214k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1099 users visited in the last hour