How to determine what allele a sample has from FASTQ data?
0
0
Entering edit mode
3.6 years ago

Hello!

I am interested in a particular gene, HLA-DRB1. I have around 10 samples that I have FASTQ (sequence) data files for. I also have a FASTA file which has all the alleles of HLA-DRB1. It is of this format:

>HLA:HLA01234 HLA-DRB1*1501 1152 bp
ATGGGGCTGGGCCCGGTCTTCCTGCTTCTGGCTGGCATCTTCCCTTTTGCACCTCCGGGA
GCTGCTGCTGAGCCCCACAGTCTTCGTTATAACCTCACGGTGCTGTCCTGGGATGGATCT
GTGCAGTCAGGGTTTCTCACTGAGGTACATCTGGATGGTCAGCCCTTCCTGCGCTGTGAC
AGGCAGAAATGCAGGGCAAAGCCCCAGGGACAGTGGGCAGAAGATGTCCTGGGAAATAAG......

My question is - how can I determine what allele each of my samples has?

Ideally, I'd just like a table that says something like..

sample_id        allele
ID_1             HLA-DRB1*1501
ID_2.            Ambigous

I had a look at a few programs but I'm not sure the best way to approach this.

RNA-Seq sequencing fastq fasta alleles • 664 views
ADD COMMENT

Login before adding your answer.

Traffic: 1452 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6