Question: Scripture Makepairedfile Question
gravatar for bruce01
7.2 years ago by
bruce010 wrote:

Hi all,

I have PE 80bp data and am running through Scripture.

I have aligned SE using tophat2 and get a SAM, sorted as per the walkthrough on the Broad website:#


for x in 1 2; do

tophat2 -o ./s1"$x".tophat.output/ -p 8 -G ~/data/endo/110831/realign/UMD/top2/PEalignment/scripture/aligns/Bostaurus.UMD3.1.66indexed.gtf --solexa1.3-qu als --library-type fr-unstranded --b2-very-sensitive Bostaurus.UMD3.1.66 ~/data/endo/110831/realign/UMD/top2/PEalignment/s1"$x"sequence.fa

samtools view ./s1"$x".tophat.output/acceptedhits.bam ./s1"$x".tophat.output/acceptedhits.sam

sed '1,2d' ./s1"$x".tophat.output/acceptedpicardrmdup.sam | sort > ./s1"$x".tophat.output/scripturehits.sorted.sam


But when I try the makePairedFile command I get a very small SAM (~300 lines). My read names grep to the thousands so this is not working on the scripture side. Any ideas about what SAM files should look like? Excerpt below:


HWUSI-EAS325L0005FC:1:7:2380:19772#0 272 chr10dna:chromosomechromosome:UMD3.1:10:1:104305016:1 38606 1 80M * 0 0 TCATTGACTCAACAAGTACATACTGCTCAATATGTTGATACTATGTCCAAAAATGTTTCTTTAACATTGGCAACACAAGA * AS:i:-5 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:77G2 YT:Z:UU NH:i:3 CC:Z:chr17dna:chromosomechromosome:UMD3.1:17:1:75158596:1 CP:i:69622293 HI:i:0

HWUSI-EAS325L0005FC:1:58:5164:20374#0 272 chr10dna:chromosomechromosome:UMD3.1:10:1:104305016:1 38612 1 80M * 0 0 ACTCAACAAGTACATACTGCTCAATATGTTGATACTATGTCCAAAAATGTTTCTTTAACATTGGCAACACAGGAAGCTAT IIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIHFGIIIIIIIIIIHHIHIHIHIIIIGIIIIIIIIHIGIIIIIIIIII AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:80 YT:Z:UU NH:i:3 CC:Z:chr17dna:chromosomechromosome:UMD3.1:17:1:75158596:1 CP:i:69622299HI:i:0


Thanks, and sorry I couldnt get italics to work on my code...


splicing transcript rna-seq • 1.6k views
ADD COMMENTlink modified 7.1 years ago by Leonor Palmeira3.7k • written 7.2 years ago by bruce010
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1491 users visited in the last hour