Entering edit mode
4.6 years ago
972050141
•
0
I have some problem about the mirdeep2 but i don't know which step I was wrong. Can you tell me what is the problem about my sequence. Think you!
#Starting miRDeep2
/home/manager/miniconda3/bin/miRDeep2.pl 5223.fa mt.fna 5223.arf none none none
miRDeep2 started at 8:49:28
mkdir mirdeep_runs/run_27_02_2021_t_08_49_28
#testing input files
sanity_check_reads_ready_file.pl 5223.fa
started: 8:49:31
[1;31mError: [0mproblem with 5223.fa
Error in line 1.918.124: Either the sequence
ACGGTCTTACGTAGGACAACCGATGACGCTTq_11687569_x1
contains less than 17 characters or contains characters others than [acgtunACGTUN]
Please make sure that your file only comprises sequences that have at least 17 characters
containing letters [acgtunACGTUN]
The input file seems corrupted, mixing a header and a sequence.