Entering edit mode
13.3 years ago
beibeichen1103
•
0
Hi,
I used novoalign to map some sequence and got this kind of result in SAM format:
SRR2002 0 * 175710298 0 23M13H * 0 0 CAATTGTCAGAGGTGAAATTCTT B>7<?99@:9<=:;569=>B@=@ PG:Z:novoalign AS:i:55 UQ:i:55 NM:i:2 MD:Z:15G0C6
It is mapped to the genome, with the match start, strand, even the mismatches are reported. However, the third column, where should be "chrN" turned out to be a star.
Any one encountered this situation? Could any body kindly tell me why this happened?
Thanks in advance!