Meme/Ame - bad file error
0
0
Entering edit mode
3 months ago
LacquerHed • 0

Hi, running into an issue I never saw on my previous HPC, when running the following command from meme/5.1.1:

ame --verbose 1 --oc cluster3_001_genes_ame --scoring avg --method fisher --evalue-report-threshold .05 --control --shuffle-- gencode.vM18.promoters.filtered.fa JASPAR2018_CORE_vertebrates_redundant_pfms_meme.meme

Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
Bad file name.
FATAL: Template does not contain data section.

Not sure if its something about the format of the motif file, shown below, but have never seen this error previously. Thanks.

MEME version 4

ALPHABET= ACGT

strands: + -

Background letter frequencies
A 0.25 C 0.25 G 0.25 T 0.25

MOTIF MA0002.1 RUNX1
letter-probability matrix: alength= 4 w= 11 nsites= 26 E= 0
 0.384615  0.076923  0.115385  0.423077
 0.461538  0.076923  0.038462  0.423077
 0.153846  0.269231  0.038462  0.538462
 0.038462  0.038462  0.000000  0.923077
 0.076923  0.000000  0.884615  0.038462
 0.076923  0.307692  0.000000  0.615385
 0.000000  0.000000  1.000000  0.000000
 0.000000  0.000000  1.000000  0.000000
 0.000000  0.038462  0.000000  0.961538
 0.307692  0.076923  0.000000  0.615385
 0.500000  0.076923  0.153846  0.269231
URL http://jaspar.genereg.net/matrix/MA0002.1
meme ame motif • 297 views
ADD COMMENT
1
Entering edit mode

Are there any answers here that help? Centrimo error: Template does not contain data section

ADD REPLY
0
Entering edit mode

Actually I figured out that its not the motif file but the fasta file itself. Something about its formatting. Looks like this:

>chr1:9545947-9547947
GCCGTTGGGGCTACAAGCGCGCCCGGGATGACACTAAAGAATGGCTGATCGAGGTGCCTGGGAGCGCCGACCCCATGGAAGACCAGTTCGCCAAGAGGACTCAGGCCAAGAAAGAACGCGTGGCCAAGAATGAGCTGAACCGTCTGCGGAACCTGGCTCG

However when I just try to substitute the genome assembly fasta, with the following format, ame runs fine:

>chr1 1
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Cant quite figure out what the issue is, I removed the coordinates from the fasta to match what the assembly looks like but no dice.

ADD REPLY
0
Entering edit mode

Perhaps ame is expecting 80 character-wide FASTA? That would be a pretty old-school requirement, but other than that, maybe check line endings, or header format. | Split a 'linearised' (flattened) FASTA sequence into multi-line using AWK | Make multi-fasta using perl

ADD REPLY

Login before adding your answer.

Traffic: 2365 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6