Gatk Complains That Picard'S Sortsam Doesn'T Sort A Bam...
Entering edit mode
13.2 years ago
Pablo ★ 1.9k

I'm having a problem trying to use GATK on an alignment performed by BWA and sorted by Picard's SortSam. The error message I get is:

Alignments added out of order in SAMFileWriterImpl.addAlignment for s_1_gC2T.realign.bam. Sort order is coordinate. Offending records are at [Group4.3:96] and [Group4.3:85]

I've sorted the BAM file using Picard, as suggested by GATK's documentation. I've also checked that whether the BAM is "properly sorted" using three simple methods:

  1. Inspect header: Marked as "SO:coordinate"

    $ samtools view -H s.sort.bam | head -n 1

    @HD VN:1.0 SO:coordinate

  2. Indexed the BAM file: No errors, suggesting that it is sorted.

  3. Simple visual inspection: Looks like it is sorted.

Here are the offending records:

seq_46302040    73      Group4.3        87      37      52M1D24M        *       0       87      TTTGAGTGTTTTTTTTATGATTTTTTGATTTTTTTGGGGGGATTTTTTTTGGTTTTTTTTGGAATGACGTTATATG    BBB=?:=><><ABBA@69A>@@?@@@6=7':@@<?;<??;615==91<=:0599978(>?7533<###########
seq_185000411   147     Group4.3        96      29      52S9M1D7M2D7M1S *       0       12      TAACACAAAAAAAAAAAAAAAAAAAAAAAAAAATGAATAAAGTAAAAATAAATTTGTTTGTATTTTTTTTTTTTTT    ############################################################################

I'm assuming that I'm missing something obvious here...any ideas?

gatk picard bwa • 6.1k views
Entering edit mode

You could try bamtools sort, and see if the problem persists.

Entering edit mode

That's what tried first and didn't work, so I used picard (as recommended in GATK pages)

Entering edit mode
12.4 years ago
nnutter ▴ 210

It may be that the order of the alignments/reads and @SQ headers are different. I ran into a similar problem recently and used Picard's ReorderSam against a reference FASTA to get the @SQ headers and alignments/reads in the correct order.

EDIT: I found that ReorderSam did not work properly with SAM files but seemed OK with BAM files. When I tried outputting a SAM file it had stripped the RNAME values from the reads.


Login before adding your answer.

Traffic: 1408 users visited in the last hour
Help About
Access RSS

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6