Question: Error While Running Trinity Rna-Seq Assembler
0
gravatar for pjyoti29
4.7 years ago by
pjyoti290
pjyoti290 wrote:

hello everyone, I am trying to run Trinity RNA-seq Assembler and has succesfully run the sample data. However, while running our data which is single-end reads in fasta format I am getting an error as "warn: Bad character in sequence". can anyone please tell me what's the issue.

thanks, Jyoti

trinity rna-seq • 1.8k views
ADD COMMENTlink modified 4.7 years ago by Shaojiang Cai90 • written 4.7 years ago by pjyoti290

could you post two or three example sequences from the fasta file?

ADD REPLYlink written 4.7 years ago by skymningen330

I have sequences in fasta format. Here are some of the example..

No_name GAAACAGGAAGGCATGGGTAG No_name ATCATATACGTTAGCCGAGCT No_name AAGATGAAGCAATGCACTTTCGTGT No_name CTATCTCAGGGATCATTAGTA

thanks, Jyoti

ADD REPLYlink written 4.7 years ago by pjyoti290

I guess the formatting messed it up, because they should look more like this:

>No_name
GAAACAGGAAGGCATGGGTAG
>No_name
ATCATATACGTTAGCCGAGCT
>No_name
AAGATGAAGCAATGCACTTTCGTGT
>No_name
CTATCTCAGGGATCATTAGTA
ADD REPLYlink modified 4.7 years ago • written 4.7 years ago by skymningen330

oh yeah...the sequence format is exactly what you have posted...there was mistake in the format in my earlier post...I am sorry for that....

ADD REPLYlink written 4.7 years ago by pjyoti290

Are there any Ns in your sequences?

ADD REPLYlink written 4.7 years ago by skymningen330
0
gravatar for Shaojiang Cai
4.7 years ago by
Singapore
Shaojiang Cai90 wrote:
  1. Your FASTA file may be not well formatted. You can find some validator or write a simple script to check whether some characters are not correct. For example, sequence can not contain spaces (e.g. ā€¯akninkslsa lgnvisalae" is not valid). Anyway, it is just a text format, you can manipulate it freely.

  2. Double check your running command, make sure your input file parameter is correct.

ADD COMMENTlink written 4.7 years ago by Shaojiang Cai90
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1440 users visited in the last hour