Question: Adaptor Order In Pe Sequencing On Illumina Hiseq
0
gravatar for Sakti
7.5 years ago by
Sakti420
United States
Sakti420 wrote:

Dear all,

This might be a stupid question, but it's better asking than wasting a whole lane of HiSeq (and my PI hating me for the rest of my degree ).

I have different regions I'd like to amplify using PCR with primers that already have ligated Illumina PE adaptors to them, as in the following scheme:

Forward primer: [P1adaptor][forward.primer.sequence]
Reverse primer: [P2adaptor][reverse.primer.sequence]

Using one of my examples:

forward primer: [ATGAGGGTCCAATCCATAAGC]
reverse primer: {AGAGACATCGGTCTCTGATGGT}

With adaptors:

forward with P1: AATGATA...CGCTCTTCCGATCT[ATGAGGGTCCAATCCATAAGC]
reverse with P2: CAAGCAG...CTCTTCCGATCT{AGAGACATCGGTCTCTGATGGT}

So the PCR product would look something like:

*[P1adaptor][forward.primer.sequence]XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX
XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX[reverse.primer.sequence][P2adaptor]*

My question is, would it matter if I swap the order of adaptors so that instead of forward primer having PE1 adaptor it has PE2??

Like this:

Reverse primer: [P1adaptor][reverse.primer.sequence]
Forward primer: [P2adaptor][forward.primer.sequence]

And with the used examples:

forward with P2: CAAGCAG...CTCTTCCGATCT[ATGAGGGTCCAATCCATAAGC]
reverse with P1: AATGATA...CGCTCTTCCGATCT{AGAGACATCGGTCTCTGATGGT}

I think it shouldn't alter anything, just basically the order in which the primer sequence is reported (reverse primer now being reported in the 1st PE reads rather than the 2nd reads). But still,I want to know if that alters the PCR reaction itself (i.e. primers going outwards instead of ampiying into the region I want)

Thanks!!!

illumina hiseq adaptor sequencing • 2.8k views
ADD COMMENTlink modified 7.5 years ago by Christof Winter990 • written 7.5 years ago by Sakti420

This is not really a bioinformatics question, more a molecular biology protocol. SEQanswers or a protocols forum might be a better place to ask.

ADD REPLYlink modified 7.5 years ago • written 7.5 years ago by Neilfws49k
1
gravatar for Christof Winter
7.5 years ago by
Lund, Sweden
Christof Winter990 wrote:

Swapping the adapter orders will merely swap read1 and read2 of your sequencing results.

primers going outwards instead of ampiying into the region I want

No, the primer has in inherent order -- polymerase always adds at the 3' end of the primer. So if your primer design is right, there is no way you could mess this up by attaching adapters to the 5' end of the primer.

ADD COMMENTlink written 7.5 years ago by Christof Winter990
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1028 users visited in the last hour