Question: Vcf-Consensus For Individuals From 1000 Genomes
2
gravatar for sophix
5.7 years ago by
sophix20
sophix20 wrote:

Hi,

I would like to create consensus sequence for an individual from 1000G where the sequence incorporates variants typed for this individual.

Using tabix and vcf-tools (vcf-subset), I extracted the relevant variant information from 1000G SNP call files.

At this point, I have variants per chromosome for individual HG000096.

I would like to incorporate these variants into reference coding sequence.

I downloaded all protein-coding sequences for the GRCh37 version from Ensembl Biomart.

An example with trimmed sequence looks like this:

>ENSG00000003137|ENST00000001146|ENSP00000001146|2|72356367|72375167
ATGCTCTTTGAGGGCTTGGATCTGGTGTCGGCGCTGGCCACCCTCGCCGCGTGCCTGGTG
TCCGTGACGCTGCTGCTGGCCGTGTCGCAGCAGCTGTGGCAGCTGCGCTGGGCCGCCACT
CGCGACAAGAGCTGCAAGCTGCCCATCCCCAAGGGATCCATGGGCTTCCCGCTCATCGGA

Note: typical fasta sequence file with the header including gene|transcript|protein|chr|chr_start|chr_end

My understanding is that there are a few alternatives out there to produce consensus sequences given a reference fasta sequence and variant call file:

  • AlternativeReferenceMaker,
  • vcf consensus
  • mpileup

I would like to use vcf-consensus for my task.

vcftools describes the use of vcf-consensus as follows:

cat ref.fa | vcf-consensus file.vcf.gz > out.fa

I presume that the reference file here refers to the reference DNA sequence including coding and non-coding parts of the genome. In that case, my protein-coding sequence above would not work as an acceptable reference sequence. Nevertheless, I am only interested in the protein-coding part.

How can I modify vcf-consensus or my input sequences to create consensus coding sequence for HG00096 given the reference coding sequence and his variants? Do I have to apply vcf-consensus to entire gene sequence first and then extract the relevant parts - which would be very tedious?

Thank you very much.

1000genomes • 3.1k views
ADD COMMENTlink modified 2.4 years ago by rajesh.msch0 • written 5.7 years ago by sophix20

cross posted on SE: http://seqanswers.com/forums/showthread.php?t=35115

ADD REPLYlink written 5.7 years ago by Pierre Lindenbaum121k
0
gravatar for rajesh.msch
2.4 years ago by
rajesh.msch0 wrote:

Hi, Same problem i am facing here.

Can anybody help me to figure out?

ADD COMMENTlink written 2.4 years ago by rajesh.msch0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1710 users visited in the last hour