Question: Demultiplex Illumina With Barcodes On Sequence Read
0
gravatar for rhasbunz
5.0 years ago by
rhasbunz10
Chile
rhasbunz10 wrote:

Hi

I trying to use a public library of GBS in maize. The llumina reads have the bardcode included in sequences like this:

+SRR836350.1 HWI-ST1085:39:D0D7RACXX:2:1101:1270:1997 length=100
#4=DFFFFHHHHHJJJJJHHIIJJIJIJJJIJFHIIJJJJIJGIJJJJHIJJIJJIHHJJIGIJIJJIGHHFFFD?CECEEEEDDDDEDDDDDDDCCAC:
@SRR836350.2 HWI-ST1085:39:D0D7RACXX:2:1101:1383:1999 length=100
NTATTACTGCGCGCCGCGCTCGCCGCGGTGCATCCGGGGCTGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGC
+SRR836350.2 HWI-ST1085:39:D0D7RACXX:2:1101:1383:1999 length=100
#4=DFFFFHHFHHJJJJJJJJJJJJJHFEDDEEDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDBBDBBDDDDDDDDDDDDDDDDDDCDD>
@SRR836350.3 HWI-ST1085:39:D0D7RACXX:2:1101:1981:1995 length=100
NGGCCAGCGAGCCTTTCTCTTCCTGCTACCACCCCACACCGCGCACACACCACCATCTCTCCTCGCCTCGCCTCCACTTCCTGGGCTACGTACCGGTCTC
+SRR836350.3 HWI-ST1085:39:D0D7RACXX:2:1101:1981:1995 length=100
#4=DFDFFHDFHHIJJIJJJJJJJIJJFHIIJJJJJIGIIJHIJIHGHFFFDDDDDCDDECCDDDDDDD5>BDDDDDCDDDDCCDDCADDDCDDDBDDDC
@SRR836350.4 HWI-ST1085:39:D0D7RACXX:2:1101:2049:1997 length=100
NTTGGATCAGCGACTGAGTCTCGCCGCGCTTTGCGATCTCGCCGAGCCAGTCGTTGACCCGCTTTAGCTGAGATCGGAAGAGCGGTTCAGCAGGAATGCC
+SRR836350.4 HWI-ST1085:39:D0D7RACXX:2:1101:2049:1997 length=100
#4=DDDFFHHHHHJJHIJHIJJJJJJIJJJJJJIJJJGHIGHHFDDDDADDDDD@AADDDDDDDDCDDDDDDCDDBD?BBDDDDDDDDDDDDDDDDDDDD
@SRR836350.5 HWI-ST1085:39:D0D7RACXX:2:1101:2090:2000 length=100
NAACGACAGCAACTGGCGCGTCGGTTGCTTGACGCGTGGGCCTGGGCTTCCAAGCTGTCGTGTCAGAAGTCGGAGAAGCGCGTCCACCTGGCGCGGCTGC
+SRR836350.5 HWI-ST1085:39:D0D7RACXX:2:1101:2090:2000 length=100
#4=DFFFFHHHHHJJJJJJJJJJJJJJJJJJJIJJJHFFDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDB
@SRR836350.6 HWI-ST1085:39:D0D7RACXX:2:1101:3303:1994 length=100
NGTGTGGTCAGCTATCTCGTGCGTGCCGGGTACTGACAGGGAACAGCGAAACGATGGGTCCGACTCCGACGCCGGTCGCCCGGCCCCTGGACCCTCGCCG
+SRR836350.6 HWI-ST1085:39:D0D7RACXX:2:1101:3303:1994 length=100
#1=DDDFDHHHHHJJJJJJIJJJIJJJJJJDHIJJJJJIJJIJJJJJJJJHHFFFDDDADDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDBDDDDDDDDB
@SRR836350.7 HWI-ST1085:39:D0D7RACXX:2:1101:3609:1992 length=100
NATCGTCTGTGACTTGAGCGGCAGGGACTGATTGTTCGGATGGCGTCTGTTCTGACATGGTCGTTCGATCAACAGTTTGATTGCTAGCATCAGGAGGCAG
+SRR836350.7 HWI-ST1085:39:D0D7RACXX:2:1101:3609:1992 length=100
#1=DFFDFHHFHHJJJJJJJJJJJJJEHIIGIIEFGGIJCHGIEHAEHEDEBCBDFEEEDAEDDDBDBDBBDDCDCADCCCDCCDDDCCDCDCDABDDDB
@SRR836350.8 HWI-ST1085:39:D0D7RACXX:2:1101:3586:1994 length=100
NTCAACAGCGAGGACGAACATAAGCCCCTGATGGGATTGCATGTGTCCGGCACATTGACATCGTCACAATTCATTCACATATAATATGCACACCACTGGC
+SRR836350.8 HWI-ST1085:39:D0D7RACXX:2:1101:3586:1994 length=100
#4=DDFFFHHHHHJJJJIJJJJJJIJJJJJIJJJJHJIJJIIJIJIJJJJHHFFFEEEEEEEDDDDDDCDDDDEDEDDDDDEEEDEEEDEDDDDDDCDDB
@SRR836350.9 HWI-ST1085:39:D0D7RACXX:2:1101:3681:1997 length=100
NGTGTGGTCTGCACTGGCCTGGATTGTGGACAGATCGATCCCCAAGAGCCCTAGGGTCTCGGCGTAGATGATGTTGGGGCTGAGATCGGAAGAGCGGTTC
+SRR836350.9 HWI-ST1085:39:D0D7RACXX:2:1101:3681:1997 length=100
#4=DDFFFHHGHHJJJJJJJJJIJJIHIJGIJIHIIJJJJJJJJJHGHIJJJJJJJFHIJJHHFBCD?DDCEDEDDDDDDDD8?@CDDDDDDABCDD@B?
@SRR836350.10 HWI-ST1085:39:D0D7RACXX:2:1101:3551:1998 length=100
NTCGATTCAGCCTCCGGCGCCCTGCTGGACGCAGGGGCGGCCTTCACAGACTTCGAACCGCCGGCGGCAGAGATCGGAAGAGCGGTTCAGCAGGAATGCC
+SRR836350.10 HWI-ST1085:39:D0D7RACXX:2:1101:3551:1998 length=100
#4=DFFFFHHHHHJJJJIJIJJJJJJJJJJJJJJJJJGDDDDDDDDDDDDDDDDDDDDDDDDDDDDDBBDBBCCDADBBBBBCBD5>?DDDCDDBBADDC

How can to make demultiplexing of sequences?

Best

Rodrigo

• 3.9k views
ADD COMMENTlink modified 5.0 years ago by Ashutosh Pandey11k • written 5.0 years ago by rhasbunz10
1
gravatar for Ashutosh Pandey
5.0 years ago by
Philadelphia
Ashutosh Pandey11k wrote:

Try these tools:

1) Eautils

https://code.google.com/p/ea-utils/wiki/FastqMultx

2) Fastx

http://hannonlab.cshl.edu/fastx_toolkit/commandline.html#fastx_barcode_splitter_usage

ADD COMMENTlink written 5.0 years ago by Ashutosh Pandey11k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1160 users visited in the last hour