Trimmomatic not recognising both adapters

Question

[OhHiImNewHere]

I received some WES samples back from a commercial sequencing company, without an adapters file, so I created an adapters.fa file that looks like this:

>Novogene adapter,PE, 5'adapter
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>Novogene adapter, PE, 3' adapter
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG

I put this into my script as ILLUMINACLIP:adapters.fa: 2:30:10.

This works but in my output file I get:

TrimmomaticPE: Started with arguments:
...
Using Long Clipping Sequence: 'GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG'
ILLUMINACLIP: Using 0 prefix pairs, 1 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Quality encoding detected as phred33
Input Read Pairs: 51487885 Both Surviving: 50756708 (98.58%) Forward Only Surviving: 0 (0.00%) Reverse Only Surviving: 0 (0.00%) Dropped: 731177 (1.42%)
TrimmomaticPE: Completed successfully

Does this mean it only looks for one of the adapters, or does it mean it did not find any of the 5' adapter?

Answer 1

[Istvan Albert]

I will say that the adapter naming is a bit weird, the difference between the names has odd whitespace. Note how both sequences are called the same:

Novogene

because the sequence id is defined as the word up until the first whitespace.

That might make Trimmomatic consider them a single sequence. In general sequences ought to have unique ids for example:

Novogene_adapter_1

and

Novogene_adapter_2

[OhHiImNewHere]

Thanks, that's really helpful. I'll edit and try again (or try with TrimGalore where you can just list the sequence).

[OhHiImNewHere]

Yep- I changed the name and it works!

[GenoMax]

Please accept Istvan's answer below (green check mark) to provide closure to this thread.