Entering edit mode
4.6 years ago
mithu18mohan
•
0
Actually was working with miRDeep2, and the error was
The mapped reference id CM000663.2 from file
ZNT16areads_vs_genome.arf
is not an id of the genome file
GCA_000001405.15_GRCh38_genomic.fa
my ZNT16areads_vs_genome.arf file format is
seq_6028_x1375 22 1 22 tccttcattccaccggagtctg CM000663.2 22 209432166 209432187 tccttcattccaccggagtctg + 0 mmmmmmmmmmmmmmmmmmmmmm
seq_7403_x1189 22 1 22 aaaccgttaccattactgagtt CM000679.2 22 28861403 28861424 aaaccgttaccattactgagtt - 0 mmmmmmmmmmmmmmmmmmmmmm
seq_8592_x1144 22 1 22 tgaggtagtaggttgtatagtt CM000671.2 22 94175962 94175983 tgaggtagtaggttgtatagtt + 0 mmmmmmmmmmmmmmmmmmmmmm
seq_8592_x1144 22 1 22 tgaggtagtaggttgtatagtt CM000684.2 22 46112752 46112773 tgaggtagtaggttgtatagtt + 0 mmmmmmmmmmmmmmmmmmmmmm
seq_8592_x1144 22 1 22 tgaggtagtaggttgtatagtt CM000673.2 22 122146568 122146589 tgaggtagtaggttgtatagtt - 0 mmmmmmmmmmmmmmmmmmmmmm
while my Genome format is
>CM000663.2_Homo_sapiens_chromosome_1,_GRCh38_reference_primary_assembly
It would be helpful if anybody can revert back with my query