Tools for searching user-specified DNA consensous sequence
0
1
Entering edit mode
5 weeks ago

Hello,

I have a set of intergenic regions (from a non reference prokaryotic genome) and I am looking for a tool that look for the presence of DNA motifs like this one: TTGNCA 16-18 TAnnnT (16-18 is a spacer).

I stumbled upon the MEME suit and I was wondering if these tools can be used to perform this kind of analysis. Also, are you aware of any alternative to MEME?

Thank you!

MEME • 135 views
ADD COMMENT
0
Entering edit mode

Please post some example data (not image).

ADD REPLY
0
Entering edit mode

Not sure if I understand but here an example of the data. I have a multi fasta file whit my intergenic regions:

>NZ_CM002177_873
CGCAACCGCGTGCAGCCGATCGCCCCACGTCGGCGGTGGTTTCATCACGCTCCCTTCAATGCATCCGAGTATGGCGGCTGCTCTTCGCAGTTGAGGGTGTAGGGCTGGTCGGCGCGTCGGTGGCCGGGTCGGCCGGCGAGGTGCCGCCGGTCGGGGTCACCCGCCCTGTGCGCTGCTGCACGCCTTTCATTATGGGCGCGCGACGCACGACCGGCTCCGGCTGGGGTTGCCCTCG
>NZ_CM002177_1450
TCGAGGACTCCTCTGCTCCTGCCGCGTCATCCGCCGGCTCTTCTCTACGGCACCGCTCGAATGCCCAGCCCGATTGTGGCTCCGGCGCCCGACATGTGCTCGAGGTAGGGCGTCGCGACGGACCCGCAGAACCTCCTCGACGCTCTCCCCACGACCGCTTTCGCCTGTTGCGATGGACGGGTTCACCGGATTCGAGGCCGCCGCCGCGAAGAGCTCCCCGAGGCGGTCGCGGTCATGGCTCCCTTCCACCTTGCCCTCCTGGGCAAGCCGGCAGGGCCGCGTGGTGCCCCACCGTCGGCCTACGGTATAAATACATCTTGTGTCT
>NZ_CM002177_2417
CCGCTACTACCACCGACCCCGGTCGGCTGCCGACACTTACGGAAACGGTCCCGCGCGGGACGTGGCTGCTC

and a second file with the consensus sequences I need to find in the intergenic regions:

>cons1
GGGAACCnnnnnnnnnnnnnnnnnGTCNAA
>cons2
GGTXXnnnnnnnnnnnnnnnGGGTAF

X can be A or T while F can be C or T

Thank you

edit: MAST from the MEME suit did the job.

ADD REPLY

Login before adding your answer.

Traffic: 2370 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6