Masurca. Failed to pre-correct Nanopore data, please check your data!
1
0
Entering edit mode
3 months ago
kamanovae ▴ 50

Hi! I have problem with Masurca. I am doing a hybrid assembly nanopore with Illumina. My config file look like this:

DATA
PE = aa 200 20 ../data/Ldec_illumina/SRR1055545_1.fastq ../data/Ldec_illumina/SRR1055545_2.fastq
PE = ab 200 20 ../data/Ldec_illumina/SRR1055547_1.fastq ../data/Ldec_illumina/SRR1055547_2.fastq
PE = ac 200 20 ../data/Ldec_illumina/SRR1055548_1.fastq ../data/Ldec_illumina/SRR1055548_2.fastq
PE = ad 200 20 ../data/Ldec_illumina/SRR1055549_1.fastq ../data/Ldec_illumina/SRR1055549_2.fastq
NANOPORE=../data/raw_data/all_passed_oneName.fastq
END

PARAMETERS
NUM_THREADS=30
JF_SIZE=600000000
USE_LINKING_MATES=0
GRAPH_KMER_SIZE=auto
END

All file paths are correct, but I have such error:

[Fri 25 Jun 2021 05:41:03 AM UTC] Processing pe library reads
[Fri 25 Jun 2021 05:41:03 AM UTC] Average PE read length 101
[Fri 25 Jun 2021 05:41:03 AM UTC] Using kmer size of 67 for the graph
[Fri 25 Jun 2021 05:41:03 AM UTC] MIN_Q_CHAR: 33
[Fri 25 Jun 2021 05:41:03 AM UTC] Estimated genome size: 1048596588
[Fri 25 Jun 2021 05:41:03 AM UTC] Computing super reads from PE
[Fri 25 Jun 2021 05:41:03 AM UTC] Using CABOG from /home/kamanova_ep/masurca/MaSuRCA-4.0.3/bin/../CA8/Linux-amd64/bin
[Fri 25 Jun 2021 05:41:03 AM UTC] Running mega-reads correction/assembly
[Fri 25 Jun 2021 05:41:03 AM UTC] Using mer size 17 for mapping, B=15, d=0.02
[Fri 25 Jun 2021 05:41:03 AM UTC] Estimated Genome Size 1048596588
[Fri 25 Jun 2021 05:41:03 AM UTC] Estimated Ploidy 1
[Fri 25 Jun 2021 05:41:03 AM UTC] Using 30 threads
[Fri 25 Jun 2021 05:41:03 AM UTC] Output prefix mr.41.17.15.0.02
[Fri 25 Jun 2021 05:41:03 AM UTC] Pre-correction and initial filtering of the long reads
[Fri 25 Jun 2021 05:41:13 AM UTC] Failed to pre-correct ../data/raw_data/all_passed_oneName.fastq file, please check your data!
[Fri 25 Jun 2021 05:41:13 AM UTC] mega-reads exited before assembly

Nanopore data is standard fastq file such this.

@457f3629-5c3a-443c-a5a7-5fe6e4990238
CTTCACGCCGGTTTCCAATTTTATCAATTTGGGTGTTTAACCGTTTTCGCATTTATCGTGAAACGCTTTCGCGTTTCGTGCATACTTCATAAATTAACAATTATATTGAGCAAAAAAACCCTGAAATGAAATAATAATGAAATAAAAAATGCAAGTAAAAATGAAACAATTGGACAAAAAATAAAAATAAAAGTACAAAATGAAAATAAAGATAAAATAAAAAAAGTTAAGATTTCAAGCCAAGTTAGTTCACGACGTTTCAGCGATTGTTAGTATCTATCGTCACACACTCCTGTATAGTGTGTTTGTCTGATTAGA
+
$&)%$)%#%#&.30*,()**)%#)*%'%&,)*297;=4''+,-06<98/)*>AC;C*0;<@?@<7<>@923<:<=1/.=-+*'&*)*,.1-*&'+448<==?DC4;>@?<@BC><;5.)7657CA@D>GEFEC?,170+*)>>A@?=3,/*786&%&6;:3(0198?;<:E;=C8=>?<82(;=B@/.>?;+(;<=6>DF@DJECB<<31*5;@>>?1LF84.+%'$&#$(++,/789-::69;=?+5972(/-2389=7'$)*0/27-1+*)00-+,'1//025917-8@9501654-+&%).07,/9

I would be grateful for your help

Nanopore Masurca • 351 views
ADD COMMENT
3
Entering edit mode
3 months ago
kamanovae ▴ 50

I found a solution on my own :) You need to install the tool numactl

apt-get install numactl
ADD COMMENT

Login before adding your answer.

Traffic: 2484 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6