Entering edit mode
4.3 years ago
priya.bmg
▴
70
Hello
I need advice on adapter trimming. I removed the Ilumina small RNA 3' adapter from my forward sequence and Ilumina Universal adapter from the reverse strand (using cutadapt). Used the adpater information from https://eurofinsgenomics.eu/media/1610545/illumina-adapter-sequences.pdf. But still could see the adapter not being removed as shown below in the fastQC report. Am I using the wrong adapter information or missing any step?
cutadapt -a ATCTCGTATGCCGTCTTCTGCTTG -o output.fastq 24_1.fastq ## remove adapter from forward strand
cutadapt -a AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT -o output2.fastq 24_2.fastq ## remove adapter from reverse strand
Thanks
Priya
It appears that you have very short inserts and
cutadaptis not making the initial matches. I am not acutadaptuser but you will need to decrease the initial seed match.With
bbduk.shfrom BBMap suite you can try:I think you need to reverse complement the adapter in this case.(Just noticed the input is two different files, forward and reverse)EDIT:
And here more info about the parameters https://cutadapt.readthedocs.io/en/stable/guide.html#adapter-trimming-parameters You may need to change the
-eand-Oparameter.