Segemehl -D option doesnt work for allowing differences
0
0
Entering edit mode
2.5 years ago
Apex92 ▴ 280

I am trying to map short some specific short reads (19~20nts) against long reads of a fasta file (F1.fasta). I used Segemehl tool and indexed the F1.fasta file (long reads) and then used the command line below to perform the alignment:

segemehl.x -i F1_reads.idx -d F1.fasta -D 2 -q short_reads.fa > mymap_segemehl.sam

My problem is that with using -D 2 to allow detection of insertions or deletions, I do not get a hit for the example long read like below:

In my short reads, I do have ATGGTGCTACGACACTGGC as an entry and in mapping this short read against the long read below, I expect to get a hit in the SAM file because if you look at the end of the long read, that part completely matches with the short read (as highlighted by the ^__^__^ segment below) except that there is an insertion in the long read (C higlighted by the second ^).

>long_read_1
TCACATGTGTATAAGAGACAGATCAGCATTATTGACCTTCAGGCGTATGTGTGCAAGTAATGGTGCCTACGACACTGGCC
                                                           ^______^___________^

Could somebody help me with this? Maybe I am using the wrong option?

Thank you.

alignment RNA-Seq segemehl • 491 views
ADD COMMENT

Login before adding your answer.

Traffic: 2796 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6