missing genotype ./. even with many reads under AD and DP
0
0
Entering edit mode
5 weeks ago
niyomiw88 • 0

Hi All,

I am trying to troubleshoot all the missing genotypes in my VCF. I don't quite understand why I get missing genotypes (./.) when there are plenty of reads under AD and DP. I think it's because the GQ also appear to be 0. Can someone confirm this or shed some light on what's going on please.

I copied some lines from the raw genotyped VCF. I used GATK4 Haplotypecaller for variant calling > CombinedGVCFs > GenotypeGVCF

PHUM306900 10716 . C T 210835.07 . AC=435;AF=0.867;AN=502;BaseQRankSum=0.654;DP=13029;ExcessHet=0.0000;FS=0.000;InbreedingCoeff=0.4908;MLEAC=755;MLEAF=1.00;MQ=60.00;MQRankSum=0.00;QD=31.27;ReadPosRankSum=1.10;SOR=0.781 GT:AD:DP:GQ:PGT:PID:PL:PS 1|1:0,52:52:99:1|1:10716_C_T:2252,156,0:10716 0|1:15,10:25:99:0|1:10716_C_T:375,0,600:10716 ./.:19,0:19:.:.:.:0,0,0 ./.:26,0:26:.:.:.:0,0,0 ./.:62,0:62:.:.:.:0,0,0

I should add that I already tried using FixVcfMissingGenotypes and it didn't change any calls on the samples I tried. Any insight would be much appreciated.

genotype vcf • 271 views
ADD COMMENT
0
Entering edit mode

when there are plenty of reads under AD and DP

show us a few reads overlaping this position using samtools view

ADD REPLY
0
Entering edit mode

Here are some from one sample. The called genotype for this is below, at position 10716;

./.:25,0,0:25:.:.:.:0,0,0,0,0,0

And few lines of BAM. The position in question is clearly there. Also, this is a known, well documented mutation associated with insecticide resistance. I am trying to understand why it won't call the genotype and not give ./. Thanks for responding.

> A00916:13:HVWGLDSXX:4:1303:24939:11866  1185    PHUM306900      10630   60      139M5S  =       10764   276     AGTCTTCAAATTGGCCAAATCGTCGCCAACGTTAAATTTATTAATTTCAATTATGGGTCGAACTGTTGGAGCTTTGGGTAATTTAA**C**ATTCGTCCTTAGAATTATAATATTCATATTAGCCTTAATGTGAATGCAACTTATTGT        FFFFF:FFFFFFFFFFFF,FFFF:FFFFFFFF:FFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFF:FFFFFFFF:FFFFFFFFFFF,FFFFF,F:FF,FF:,F,,FFFFFFF,F,:,F,FFFFF,,F:FF:FFFFFFF,        MC:Z:68M2I74M   MD:Z:23G73T1C5C11T3G1T3G11      PG:Z:MarkDuplicates     RG:Z:LHA-Seq5-HVWGLDSXX.4.94    NM:i:8  AS:i:99 XS:i:0
A00916:13:HVWGLDSXX:4:1303:25183:11788  1185    PHUM306900      10630   60      97M47S  =       10764   276     AGTCTTCAAATTGGCCAAATCGTCGCCAACGTTAAATTTATTAATTAAAATTATTGGTCTAAATGATGGAGCTTTGGGTAATTTAA**C**ATTCCTCCTTAGAATTAAAATAATAAAATTAGCCCTAATGACAATGCAACTTATAGT        F:FFFFFFFFFF:FFFFFF:FFF,FF:FFFFF:F:FFFFFFFFFFF,,,F:FFF,FFFF,,FFF,,FF,FFF,FFFFFFFFF:FFFFFFFFF:FFF:F:,FF,,F,F::,:,:FFFF:FFFFF,,FF,,FF::,F,F,F,F,F,        MC:Z:68M2I74M   MD:Z:23G22T0C6G4G2C2T25G5       PG:Z:MarkDuplicates     RG:Z:LHA-Seq5-HVWGLDSXX.4.94    NM:i:8  AS:i:57 XS:i:0
A00916:13:HVWGLDSXX:4:1303:25192:11772  1185    PHUM306900      10630   60      144M    =       10764   276     AGTCTTCAAATTGGCCAAATCGAGGCCAACGTTAAATTTATTAATTTCAATTATGGGTCGAACTGTTGGAGCTAGGGGTAATTTAA**C**ATTCGTCCTTTGCATTCACATATTCATAATAGCCGTTATGTGACTGCAACTTTTAGG        :FFF:FFFFFFFFFFF,F,:FF,FFFFFFFFFFFFFFF,FFFF,FFFF,FF:F:FFF:FF:FF:F:F:FFFF,,FFFFFF,FFFFFFFF,FF,FFFFFFF,F:F,FFFF:FFFFF,F,FFFFF,,,F,FF,FF,F,F:FFF:FF        MC:Z:68M2I74M   MD:Z:22T50T0T28A0T10T1T9G2A10T2 PG:Z:MarkDuplicates     RG:Z:LHA-Seq5-HVWGLDSXX.4.94    NM:i:10 AS:i:96 XS:i:0
A00916:13:HVWGLDSXX:4:1350:14516:19304  161     PHUM306900      10630   60      144M    =       10764   276     AGTCTTCAAATTGGCCAAATCGTGGCCAACGTTAAATTTATTAATTTCAATTATGGGTCGAACTGTTGGAGCTTTGGGTAATTTAA**C**ATTCGTCCTTTGCATTATCATATTCATATTTGCCGTTATGGGAATGCAACTTTTTGG        FFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFF:F:FFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFF        MC:Z:68M2I74M   MD:Z:144        PG:Z:MarkDuplicates     RG:Z:LHA-Seq5-HVWGLDSXX.4.94    NM:i:0  AS:i:144        XS:i:0
A00916:13:HVWGLDSXX:4:1362:8250:5134    1185    PHUM306900      10630   60      144M    =       10764   276     AGTCTTCAAATTGGCCAAATCGTGGCCAACGTTAAATTTATTAATTTCAATTATGGGTCGAACTGTTGGAGCTTTGGGTAATTTAA**C**ATTCGTCCTTTGCATTATCATATTCATATTTGCCGTTATGGGAATGCAACTTTTTGG        FFFF:FFFFFFFFFFF:F:FFFFF:FFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFF:FF:FFFFFFF:FFFFF:FFFFFFFF:FFFFFFFF:FFFFFFF:FFFFFFFFFFFF:FFFFFFFFFFF:FF:FFF:F:FFFF        MC:Z:68M2I74M   MD:Z:144        PG:Z:MarkDuplicates     RG:Z:LHA-Seq5-HVWGLDSXX.4.94    NM:i:0  AS:i:144        XS:i:0
A00916:13:HVWGLDSXX:4:1522:18710:36808  1185    PHUM306900      10630   60      144M    =       10764   276     AGTCTTCAAATTGGCCAAATCGTGGCCAACGTTAAATTTATTAATTTCAATTATGGGTCGAACTGTTGGAGCTTTGGGTAATTTAA**C**ATTCGTCCTTTGCATTATCATATTCATATTTGCCGTTATGGGAATGCAACTTTTTGG        F:FFFFFFFFFF,FFFFFFFFFFFFFFFFFFF,FF:F:FFFFFFFFFFFFFFFFF:,F,FFF:FF,:FF:FF,FFFFFFFFFFFFF,FFFFFFFF:FFFF:FFFFFFFFFFFFFFF:FFFFFF:,FFFFFFFF,F:FF:FF,FF        MC:Z:68M2I74M   MD:Z:144        PG:Z:MarkDuplicates     RG:Z:LHA-Seq5-HVWGLDSXX.4.94    NM:i:0  AS:i:144        XS:i:0
A00916:13:HVWGLDSXX:4:1619:10827:10848  1185    PHUM306900      10630   60      144M    =       10764   276     AGTCTTCAAATTGGCCAAATCGTGGCCAACGTTAAATTTATTAATTTCAATTATGGGTCGAACTGTTGGAGCTTTGGGTAATTTAA**C**ATTCGTCCTTTGCATTATCATATTCATATTTGCCGTTATGGGAATGCAACTTTTTGG        FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFF:FFFFFFF:        MC:Z:68M2I74M   MD:Z:144        PG:Z:MarkDuplicates     RG:Z:LHA-Seq5-HVWGLDSXX.4.94    NM:i:0  AS:i:144        XS:i:0
A00916:13:HVWGLDSXX:4:2126:24071:11021  1185    PHUM306900      10630   60      144M    =       10764   276     AGTCTTCAAATTGGCCAAATCGTGGCCAACGTTAAATTTATTAATTTCAATTATGGGTCGAACTGTTGGAGCTTTGGGTAATTTAA**C**ATTCGTCCTTTGCATTATCATATTCATATTTGCCGTTATGGGAATGCAACTTTTTGG        FFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFF:FFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFF:FFF,:FFFF:FFFFFFFFFFFFFFFFFFFFFF:FFFFFF:FFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFF        MC:Z:68M2I74M   MD:Z:144        PG:Z:MarkDuplicates     RG:Z:LHA-Seq5-HVWGLDSXX.4.94    NM:i:0  AS:i:144        XS:i:0
A00916:13:HVWGLDSXX:4:2431:17228:9659   1185    PHUM306900      10630   60      144M    =       10764   276     AGTCTTCAAATTGGCCAAATCGTGGCCAACGTTAAATTTATTAATTTCAATTATGGGTCGAACTGTTGGAGCTTTGGGTAATTTAA**C**ATTCGTCCTTTGCATTATCATATTCATATTTGCCGTTATGGGAATGCACCTTTTTGG        FFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFF::FFFFFFFFFFFFFFF:FFFFFFFFFF:,,FFFFFFFFF:,FFFFFF,,F:FFFFFFFFFFFF:FFFF::,F::FF,FFFF,FFFFFFFF:F,FFFF,FFF:,FF,FFFF:        MC:Z:68M2I74M   MD:Z:135A8      PG:Z:MarkDuplicates     RG:Z:LHA-Seq5-HVWGLDSXX.4.94    NM:i:1  AS:i:139        XS:i:0
A00916:13:HVWGLDSXX:4:2660:11153:33833  1185    PHUM306900      10630   60      144M    =       10764   276     AGTCTTCAAATTGGCCAAATCGTGGCCAACGTTAAATTTATTAATTTCAATTATGGGTCGAACTGTTGGAGCTTTGGGTAATTTAA**C**ATTCGTCCTTTGCATTATCATATTCATATTTGCCGTTATGGGAATGCAACTTTTTGG        FFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:F:F:FFF:FFF:FFFFFFFFFFFFFFF:F:F:,FFFF::FFFFFF:FFFFFFF:FFFFFFFFFFFFFFFFFFFFFFF:FFFFF:FFFFF:FF:F:FFFFFFFF        MC:Z:68M2I74M   MD:Z:144        PG:Z:MarkDuplicates     RG:Z:LHA-Seq5-HVWGLDSXX.4.94    NM:i:0  AS:i:144        XS:i:0
A00916:13:HVWGLDSXX:4:1472:23556:12790  1121    PHUM306900      10697   60      144M    =       10742   187     GGAGCTTTGGGTAATTTAACATTCGTCCTTTGCATTATCATATTCATATTTGCCGTTATGGGAATGCAACTTTTTGGTAAAAATTACACGGGTAAAAATTAAATTTATTATTTCATTCTCCATTCTTTTTAAAATAAAAAAAAA        FFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,F        MC:Z:90M2I52M   MD:Z:77A32A2A0T1A0T26   PG:Z:MarkDuplicates     RG:Z:LHA-Seq5-HVWGLDSXX.4.94    NM:i:6  AS:i:114        XS:i:0
A00916:13:HVWGLDSXX:4:1472:23610:12790  97      PHUM306900      10697   60      144M    =       10742   187     GGAGCTTTGGGTAATTTAACATTCGTCCTTTGCATTATCATATTCATATTTGCCGTTATGGGAATGCAACTTTTTGGTAAAAATTACACGGGTAAAAATTAAATTTATTATTTCATTCTCCATTCTTTTTAAAATAAAAAAAAA        FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
ADD REPLY
1
Entering edit mode

most reads have flag=1185 ( ~ PCR duplicates)

ADD REPLY
0
Entering edit mode

I did not realize that PCR duplicates still counts as reads and appear under DP. Thank you for pointing that out. I have about 500 samples and do you have any ideas about how I should verify that PCR duplicates is the reason for missing calls even with DP>10, or do you know something else that might cause this to happen?

ADD REPLY

Login before adding your answer.

Traffic: 2311 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6