Trinity --SS_lib_type command
0
0
Entering edit mode
5 months ago
Princy ▴ 40

Hello, I need to do Trinity. what should I write in --SS_lib_type or whether it is non-strand-specific reads. I have paired-end fastq files. Is SO_2861_PIT_trim_1P.fq file is forward and SO_2861_PIT_trim_2P.fq file is reverse? The first file looks like this.

 head Fish_Data-2/trinity_BR/SO_2861_PIT_trim_1P.fq
@MG00HS12:390:C3VVMACXX:7:1101:1571:1858 1:N:0:GTCCGC
NTCTGATATAACATTTCACATTGGTGCTAAGCGATTTATGGCAATATGATGTGGCCAAAATGACCTTAACAATATGTTCTAGTATATTATCGCTCAAAAAA
+
#1=DDDDDHAFHHIJJGIJJJJGIHHIJEHIIJHJGIGHJIJJGIHEBBHGIJJJJIIHIIJIJJJHGIIJIICHHE>?EHHBEFFFFFFEABEBDCC>A=
@MG00HS12:390:C3VVMACXX:7:1101:1746:1901 1:N:0:GTCCGC
NGACTACGTTATTGAAGAGCCGCTGGTTATCTGATGCTCTCCCCTGGTTCACCAACAAACTAACCAGCACCACCGACAACAGCACTAATGCTCTAGCCATT
+
#1=DDFFFHGHHHIIJIJJJJIIJIIJIGHGIBHGEHGGIIJCHIJIGHGIJIGIIIJJJIGHHHEFBEFDECDDDDDDDDDDDDDDDDDCACDDDDDCDD
@MG00HS12:390:C3VVMACXX:7:1101:1686:1920 1:N:0:GTCCGC
NTGATGTTGTAAACATTAGGTATGCAGGAAATAATGACTTTATTTTTTAAAAGAATGAACACTTGACCTTTAAATCATATTAAATGAATGTGCATATGTAG

2nd file looks like this

>  head Fish_Data-2/trinity_BR/SO_2861_PIT_trim_2P.fq
@MG00HS12:390:C3VVMACXX:7:1101:1571:1858 2:N:0:GTCCGC
ACTCGAGTGAACCCATCCATTTAGATTACAATTTCAACACTGATCTTAAGCCTTTTTTGAGCGATAATATACTAGAACATATTGTTAAGGTCATTTTGGCC
+
CCCFFFFDHHFHHJF>FHGHGEEDHHHHIIIJEHCFGI>DHIGDAFIIIGGFHIJJJJH@FIGJGHHDFFFFEFDCDEEEDDDEED@ACCAC@CEEEDBCD
@MG00HS12:390:C3VVMACXX:7:1101:1746:1901 2:N:0:GTCCGC
AAGAGTTTGTCTACCCTGAGCGAAATGGCTAGAGCATTAGTGCTGTTGTCGGTGGTGCTGGTTAGTTTGTTGGTGAACCAGGGGAGAGCATCAGATAACCA
+
BCCDFFFFHHGHHJJJJIGIJIIJIJJIIJJJGGGEGHH>?FEH<?FGHGFHAG<;DEHHIAEEB>;@@DFBCAB;@CB?ABBD8@<B?>CCCDCCCCDDC
@MG00HS12:390:C3VVMACXX:7:1101:1686:1920 2:N:0:GTCCGC
GAATATTCATTATGTTTCCATTTGCATCACAAATTGGCATTGTTGCAGAAAATGTCTGATCTCATTTTAAGGAGAGATACAAACTGTAGCCATAGACAGAA
NGS Trinity fastq • 395 views
ADD COMMENT
0
Entering edit mode

long story short, you should contact the person/facility that prepared the library and ask whether or not the library is strand-specific: link

ADD REPLY
0
Entering edit mode

To add a bit of clarification, if you don't have a reference genome available (likely here) then you will need to ask the provider that made the libraries. Otherwise infer_experiment.py from RSeQC or even salmon can be used (if you have a transcriptome available).

ADD REPLY

Login before adding your answer.

Traffic: 2102 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6