PE reads bam files

Question

[mokbel73]

Hello guys!

Can someone explain to me the difference between ab, ba tags in bam files? I have tags that looks like this:

ATGGCAGCCTAGCACAAGAGGCTT.ab.1

OR

ATGGCAGCCTAGCACAAGAGGCTT.ba.1

I understand that ab, ba refers to forward and reverse strands but why they are followed by a number 1 and 2 ? what do these numbers mean.

ATGGCAGCCTAGCACAAGAGGCTT.ab.1 
ATGGCAGCCTAGCACAAGAGGCTT.ab.2
ATGGCAGCCTAGCACAAGAGGCTT.ba.1
ATGGCAGCCTAGCACAAGAGGCTT.ba.2  

I appreciate your help!

[ATpoint]

I have actually no clue what we are looking at here. Can you explain where these sequences are from (a command line would be preferred) and how this relates to BAM files?

[mokbel73]

Thank you for your reply! Basically when you iterate over the reads in a PE-reads bam file you get to see the sequences that form a consensus at the end. I'm using pysam in python.

I have 2 BAM files. One for consensus sequence and one for the PE reads that form these consensuses.

example code in the following image

https://pysam.readthedocs.io/en/latest/api.html?highlight=query_name#pysam.AlignedSegment.query_name

ATGGCAGCCTAGCACAAGAGGCTT ---> this is called a tag and it refers to the molecule from the sequencing machine basically and helps you identify the consensus sequence in your BAM file but in PE reads BAM file it looks like this instead :

ATGGCAGCCTAGCACAAGAGGCTT.ba.2 or ATGGCAGCCTAGCACAAGAGGCTT.ba.1 etc..

ab is for forward reads and ba is for reverse but I want to know what the numbers mean.

sorry if my explanation made things even more complicated or ambiguous.