How to convert the spot_id into Gene symbol (Platform GPL13825)

Question

[368198684]

Hi! This is my first post.

The problem happens when I tried to analyze GSE175626 from GPL13825.

I tried to locate the gene symbol, but the only info provided was SPOT_ID and gene sequence.

I have tried several online tools including "DAVID" and "mygene"

Thanks!

The head of the Data table is below:

ID  adj.P.Val   P.Value t   B   logFC   ROW SPOT_ID SPOT_ID.1   SEQUENCE
23121   0.00000127  3.68E-11    -1.44E+02   14.561297   -8.08904299 8   ASHG19A3A046793 ASHG19A3A046793 CGACCACTGATGAGATCAACAACAGGTGAACTATAAACCTATTATTTATTGCAGAACTAA