BLAST: overflow error
0
1
Entering edit mode
22 months ago

Hi, I'm using blastn in BLAST 2.11.0 and it keeps failing for specific sequences for a reason that I'm yet to understand. Any lead on what he problem might be? The error message is

Error: NCBI C++ Exception:
T0 "/tmp/BLAST/2.11.0/gompi-2020b/ncbi-blast-2.11.0+-src/c++/src/serial/objistrasnb.cpp", line 499: Error: (CSerialException::eOverflow) byte 132: overflow error ( at [].[].gi)
T0 "/tmp/BLAST/2.11.0/gompi-2020b/ncbi-blast-2.11.0+-src/c++/src/serial/member.cpp", line 767: Error: (CSerialException::eOverflow) ncbi::CMemberInfoFunctions::ReadWithSetFlagMember() - error while reading seqid ( at Blast-def-line-set.[].[].seqid.[].[].gi)

Whenever that happens, BLAST stops and the job fails. By splitting the fasta file in individual sequences, I've managed to isolate two examples of sequences that work and don't. This sequence is fine:

>S11_66329
ACTTTGAGCAGGAATAATTGGAACATCTTTAAGATTAATAATTCGATTAGAGTTAGGAACACCATCATCACTTATTAACAATGATCAATTTTATAATTCTATTATTACAGCTCATGCTCTAGTAATAATTTTTTTTATAGTTATACCAATTATAATT

But this sequence produces the error:

>S11_66321
CATGTCTTATGCTATGGTAGTTTAACAGCAAGCGTTTACTTTTTTTAATGTGTAATTATAATTTCCATATGGTCTTATCAATTAAAAAACTTTTGTCATTGCTTGTCCAATGTAGGTCACTAAAATTGGTCGAGATGCAGTTCTGTATGTGGAGTCTTTGATTGAGTCTATTATGGGAGGATTGGAAGGGTTGATCAATATTCTGGATTCTGAT

Command ran is (with test.fna containing the two above sequences):

blastn -query test.fna -db /nfs/scratch/shared_spaces/blastdb/nt/nt_20220427/nt -out test -num_threads 8 -max_hsps 5 -max_target_seqs 1 -outfmt "6 qseqid sseqid pident length mismatch gapopen qstart qend sstart send evalue bitscore sscinames staxids"
BLAST • 1.8k views
ADD COMMENT
0
Entering edit mode

Can you provide your command line? Which db are you blasting against? Local or remote at NCBI.

ADD REPLY
0
Entering edit mode

I've updated the question, cheers! I'm using a local indexed nt database.

ADD REPLY
0
Entering edit mode

I don't know the reason of the issue, but I recall having seen a similar question on Stack Overflow. I think, the newer version solved it...

ADD REPLY
0
Entering edit mode

Did you ever find a solution? I'm getting the same error code and am not sure what's wrong. Running blast+ 2.11.0 as well with a built-in database on a server.

ADD REPLY
0
Entering edit mode

If possible download the latest blast+ executable from https://ftp.ncbi.nih.gov/blast/executables/LATEST/

ADD REPLY

Login before adding your answer.

Traffic: 1470 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6