Question

trimming adapter sequences

0

Entering edit mode

3.5 years ago

biology_inform ▴ 60

enter image description here Hi all, I have dataset from GEO database and I dont know the adapter sequences which were used. When I run fastqc I get results which I attached as image. I cannot find the adaptor sequences how can i find it ? platform illumina nextseq 500

adapter fastqc rnaseq • 909 views

ADD COMMENT • link updated 3.5 years ago by Istvan Albert 103k • written 3.5 years ago by biology_inform ▴ 60

score 1 · Answer 1 · 2022-05-05

1

Entering edit mode

3.5 years ago

Istvan Albert 103k

It is the Illumina Universal Adapter

use the following sequence

>adapter
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC

ADD COMMENT • link 3.5 years ago by Istvan Albert 103k