3 reads with the same ID in sam file
1
0
Entering edit mode
11 days ago
Zhang Yun • 0

I have sam files for the chimeric reads, which come from two different parts of the genome (For example, the first half of the read from part of Chromosome 1 and the second half of the read from part of Chromosome 3). I found 3 reads with the same ID in the sam files. Could anyone explain this? Thanks!

L180:234:HTHGMADXX:1:1101:1137:6179 99  V   10092485    60  29S33M  =   10092488    63  ACATGTGCGAAAAAAAAACTTTGAGTATTTTGTGCGTTGATGATGTTGGGGGAATGAGTGTG  BBBFFFFFFFFFFIIIIIFFFIFIFFFIFBFFFFIIBFFIIFIIIBFFFFFFBFFFFFBB<B  NM:i:0  MD:Z:33 MC:Z:60M    AS:i:33 XS:i:0  SA:Z:V,10092453,-,29S33M,60,0;

L180:234:HTHGMADXX:1:1101:1137:6179 2163    V   10092453    60  29H33M  =   10092488    63  ACAAAATACTCAAAGTTTTTTTTTCGCACATGT   FFFBFIFFFIFIFFFIIIIIFFFFFFFFFFBBB   NM:i:0  MD:Z:33 MC:Z:60M    AS:i:33XS:i:0   SA:Z:V,10092485,+,29S33M,60,0;

L180:234:HTHGMADXX:1:1101:1137:6179 147 V   10092488    60  60M =   10092485    -63 TGCGTTGATGATGTTGGGGGAATGAGTGTGACGAAATTGAAAAACTAAAAGCAGAAGTAG    IIFIIIIIIIIFFIIIIIIIIIIIIIIIIFFIIIIIIIIIIIIFIFIFFFFFFFFFFBBB    NM:i:0  MD:Z:60 MC:Z:29S33M AS:i:60 XS:i:0
sam alignment samtools • 168 views
ADD COMMENT
0
Entering edit mode

could they just be multimapping?

ADD REPLY
2
Entering edit mode
11 days ago

second read has flag 2163 : it's a SUPPLEMENTARY alignment . https://broadinstitute.github.io/picard/explain-flags.html

ADD COMMENT
0
Entering edit mode

Thanks! Could you explain the meaning of supplementary alignment since the website does not have a clear explanation.

ADD REPLY
1
Entering edit mode

https://www.slideshare.net/lindenb/ngsformats

slide 44: a part of the read that maps elsewhere. The first 29 base of the read are hard-clipped. see SA:Z flag. A part of the read also maps at V:10092485

ADD REPLY

Login before adding your answer.

Traffic: 824 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6