3 reads with the same ID in sam file
Entering edit mode
23 months ago
Wang Cong ▴ 10

I have sam files for the chimeric reads, which come from two different parts of the genome (For example, the first half of the read from part of Chromosome 1 and the second half of the read from part of Chromosome 3). I found 3 reads with the same ID in the sam files. Could anyone explain this? Thanks!


L180:234:HTHGMADXX:1:1101:1137:6179 2163    V   10092453    60  29H33M  =   10092488    63  ACAAAATACTCAAAGTTTTTTTTTCGCACATGT   FFFBFIFFFIFIFFFIIIIIFFFFFFFFFFBBB   NM:i:0  MD:Z:33 MC:Z:60M    AS:i:33XS:i:0   SA:Z:V,10092485,+,29S33M,60,0;

sam alignment samtools • 739 views
Entering edit mode

could they just be multimapping?

Entering edit mode
23 months ago

second read has flag 2163 : it's a SUPPLEMENTARY alignment . https://broadinstitute.github.io/picard/explain-flags.html

Entering edit mode

Thanks! Could you explain the meaning of supplementary alignment since the website does not have a clear explanation.

Entering edit mode


slide 44: a part of the read that maps elsewhere. The first 29 base of the read are hard-clipped. see SA:Z flag. A part of the read also maps at V:10092485


Login before adding your answer.

Traffic: 2612 users visited in the last hour
Help About
Access RSS

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6