3'tsRNA alignment
0
0
Entering edit mode
6 days ago
aranyak111 • 0

3prime tsRNA is a part of a tsRNA which has some implications in the field of cancer we are investigating as a group in Stanford Alignment strategy- I have a reference sequence of the length of 25 nucleotides. (The length of the sequence is itself 22 nucleotides along with a CCA tail). I am using a bowtie to build a reference sequence using default parameters to build the genome index and subsequently doing alignments. A representative reference sequence is

Homo_sapiens_tRNA-Lys-TTT-13-1-p GGTTCAATCCCTTGCTGGGGCGCCA

The fastq file which I want to align has small RNA sequences of varying lengths. The distribution of length for my fastq files is from 1 – 76 .Majority of the reads are in the range of 15-25 nucleotides. I am selecting each of the sequences based on barcode sequences and then doing adapter trimming for both the 3 prime and 5 primes. end.

Index building step- Bowtie2 index -bowtie-build miRNA.3tsRNA25bp.mt.nmt-tRNA.fa iRNA.3tsRNA25bp.mt.nmt-tRNA

Index alignment- Bowtie2 alignment- bowtie2 -x microRNA_data -U tsRNA_filtered_1. fastq -S ysRNA_filtered_1.sam

I am using samtools idxstats to count the number of alignments and the length of alignments is always 25 nucleotides 1) I have two related questions. Is it the fact that if I use a reference sequence that is of the length of 25 nucleotides then when we do alignment bowtie will it do an exact matching and will detect a length of only 25 nucleotides from the fastq file has read of varying nucleotide distribution?

2) I am interested in 3prime ts RNA reads that are of length from 14-25 nucleotides. Is there a way to detect reads of length by capturing all the reads that have count sizes within that range when I use the reference sequence of length 25 nucleotides? Any information will be helpful.

Genomics • 81 views
ADD COMMENT

Login before adding your answer.

Traffic: 1730 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6