Overrepresented sequence and trimming
0
0
Entering edit mode
7 weeks ago
hyejo • 0

Hello, I ran CRISPR/CAS9 whole genome screening. The NGS was done by HiSeqX and TruSeqDNA library.

Two of my samples resulted in low mapping ratio, so I did FastQC. I found that there were overrepresented sequences, so I think I should remove them.

Sequence Count Percentage TCGATAGCAATTCGCTTTATATATCTTGTGGAAAGGACGAAACACCCACT 68852399 42.49 No Hit

I did cutadapt using the exact same sequence. cutadapt -a TCGATAGCAATTCGCTTTATATATCTTGTGGAAAGGACGAAACACCCACT -o output.fastq.gz 2nd_2_Control_1.fastq.gz

However, I don't get the result what I expected even after trimming, still resulting low mapping rate. I am looking for a solution for my trimming process.

enter image description hereenter image description here

Thanks in advance!!!

FASTQC • 165 views
ADD COMMENT
0
Entering edit mode

You may want to use a proper tool designed to handle CRISPRseq data: https://github.com/afombravo/2FAST2Q

ADD REPLY

Login before adding your answer.

Traffic: 1468 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6