STAR solo set parameters for scrna-seq
1
2
Entering edit mode
11 months ago
t.ru ▴ 20

Hi,

I have a fasta file similar to this

@SRR17050039.1 NB501465:544:HF2H7BGXB:1:22104:14442:1233_TCCTGAGC_barcode=NA-EEEE-AAAAAEE-EEEEEEEE-GCTG-TGCCAGA-ACGTTCAT-W202012/1
GCCCTGTAATTGGAATGAGTCCACTTTAAATCCTTTA
+
EEEEEEEEEEEEEE/EEEEEAEEEEEEE6EEEEEEEE
@SRR17050039.2 NB501465:544:HF2H7BGXB:1:22104:12136:1233_TCCTGAGC_barcode=NA-EEEE-AAAAAEE-EEEEEEEE-GCTG-GACACCT-ATTGTTTG-W202303/1
GTCCCCAGCGCTTCCCCAATGCCCAGCGGGCCTTTGC
+

I need to set a parameters for STAR solo alignment. I am really confused to find about the position of barcode + UMI in the fasta sequence. I need to set parameters similar to this for paired end.

--soloBarcodeMate 1   --clip5pNbases 39 0
--soloType CB_UMI_Simple   --soloCBstart 1   --soloCBlen 16   --soloUMIstart 17   --soloUMIlen 10
--readFilesIn read1.fq

(https://gensoft.pasteur.fr/docs/STAR/2.7.9a/STARsolo.html)

Could you help me? Thank you.

solo STAR • 775 views
ADD COMMENT
0
Entering edit mode

a fasta file similar to this

This is not a fasta file It is a fastq format file.

Are you sure this is single cell RNAseq data? Looking at the SRA accession this appears to be a single 37 bp read. This does not seem to align with standard 10x like read lengths.

ADD REPLY
0
Entering edit mode

it's single cell mars-seq. Yes sorry its a fastq file.

ADD REPLY
0
Entering edit mode
11 months ago

This is an amazing resource and seems to contain info on the Mars-seq library design. https://github.com/Teichlab/scg_lib_structs

Keep in mind generally the R1 fastq contains the cell and UMI info, the R2 contains the mRNA read.

ADD COMMENT

Login before adding your answer.

Traffic: 2233 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6