Question: Error On Executing "Local Realign" Step Of Call For The Input Bam File
gravatar for febz.babz
5.0 years ago by
febz.babz0 wrote:

Hi Biostar,

I am executing "Local Re-align" step of CALL and got the below exception:

ERROR MESSAGE on executing "local realign" step of CALL for the input BAM file: Error caching SAM record HSQ1009_86:8:2203:8087:125077, which is usually caused by malformed SAM/BAM files in which multiple identical copies of a read are present. Please help me to figure out reason for the duplicate values in the bam file even after doing "MarkDuplicates" on the input file bam file.

Execution Steps:


  1. Input file for CALL stage: ars200000001.sorted.markDup.bam

  2. Executed the first stage of CALL ie, "Create Realigner region". Output file ars200000001.forRealigner.intervals is created with the positions which needs re-alignment. Command: 'java -Xmx8g -jar /knome-pd/fbaby/isys/ksuite/software/kgap-core/thirdparty/gatk/GenomeAnalysisTK.jar -T RealignerTargetCreator -l INFO -I /knome-pd/fbaby/isys/ksuite/seqdata/ars/200000001/ars200000001.markdup.sorted.bam -R /knome-pd/fbaby/isys/ksuite/refdata/refgenome/hg19/human_hg19_full.fasta -o /kfs/scratch/fbaby-piid/realigner/200000001.chr{}.forRealigner.intervals -known /knome-pd/fbaby/isys/ksuite/refdata/refgenome/dbsnp/00-All.vcf

  3. Executed "Local Re-align" step: java -Xmx8g -jar /knome-pd/fbaby/isys/ksuite/software/kgap-core/thirdparty/gatk/GenomeAnalysisTK.jar -T IndelRealigner -l INFO -I /knome-pd/fbaby/isys/ksuite/seqdata/ars/200000001/ars200000001.sorted.markDup.bam -R /knome-pd/fbaby/isys/ksuite/refdata/refgenome/hg19/human_hg19_full.fasta --maxReadsInMemory 1500000 -targetIntervals /kfs/scratch/fbaby-piid/realigner/ars200000001.forRealigner.intervals -o /kfs/scratch/fbaby-piid/cleaned/ars200000001.sorted.markDup.cleaned.bam -known /knome-pd/fbaby/isys/ksuite/refdata/refgenome/dbsnp/00-All.vcf Got below shown error while executing:

    2014/03/17 20:43:50 [pid=2471 tid=15(CmdUtils-stderr)] [ERROR] (CmdUtils$ ##### ERROR MESSAGE: Error caching SAM record HSQ1009_86:8:2203:8087:125077, which is usually caused by malformed SAM/BAM files in which multiple identical copies of a read are present.

  4. Verified the bam file and got the below duplicate values in the bam file:

    samtools view ars200000001.sorted.markDup.bam | grep "HSQ1009_86:8:2203:8087:125077"

    HSQ1009_86:8:2203:8087:125077 147 8 108630732 1 38M62S = 108630733 -37 ACATATATACATGTGTATATAAATATATACATATATAGATGTGTATATAAATATATACATATATACATGTGTATATAAATATATACATATATACATGTGT EIIGJIIECIHGIHFDIIIGGJJIIGHGGJIIIEHGD<igjjjjjhihiijjiiihgjjiiiighijjijjiiiijjjjiiijihjjhhhhhfffffccc sa:z:8,108630733,-,57s36m7s,1,0;8,108630733,-="" ,29s36m35s,1,1;="" pg:z:markduplicates="" rg:z:na12878_30x_pairend="" nm:i:1="" as:i:37="" xs:i:36<="" p="">


    HSQ1009_86:8:2203:8087:125077 2147 8 108630733 0 57H36M7H = 108630732 37 CATATATACATGTGTATATAAATATATACATATATA JJJJJJJDFFGHGJ@FIIIIIIJJIJJJJIJJJJIG SA:Z:8,108630733,+,29S36M35S,0,0;8,108630737,+,5S32M63S,0,0; PG:Z:MarkDuplicates RG:Z:NA12878_30x_pairend NM:i:0 AS:i:36 XS:i:29

    HSQ1009_86:8:2203:8087:125077 2195 8 108630733 1 57H36M7H = 108630733 -36 CATATATACATGTGTATATAAATATATACATATATA JJIIIIGHIJJIJJIIIIJJJJIIIJIHJJHHHHHF SA:Z:8,108630732,-,38M62S,1,1;8,108630733,-,29S36M35S,1,1; PG:Z:MarkDuplicates RG:Z:NA12878_30x_pairend NM:i:0 AS:i:36 XS:i:29

    HSQ1009_86:8:2203:8087:125077 2195 8 108630733 1 29H36M35H = 108630733 -36 CATATATAGATGTGTATATAAATATATACATATATA JIIIEHGD<igjjjjjhihiijjiiihgjjiiiigh sa:z:8,108630732,-,38m62s,1,1;8,108630733,-,57s36m7s,1,0;="" pg:z:markduplicates="" rg:z:na12878_30x_pairend="" nm:i:1="" as:i:31="" xs:i:28<="" p="">

    HSQ1009_86:8:2203:8087:125077 2147 8 108630737 0 5H32M63H = 108630732 33 TATACATGTGTATATAAATATATACATATATA EFFDCDFHFHHIJJJJJJIJJJJJJJJJJJGD SA:Z:8,108630733,+,29S36M35S,0,0;8,108630733,+,57S36M7S,0,0; PG:Z:MarkDuplicates RG:Z:NA12878_30x_pairend NM:i:0 AS:i:32 XS:i:28

  5. Also used ValidateSamFile.jar to validate the bam file and got the below shown exception:

    java -Xmx48g -jar /knome-pd/fbaby/isys/ksuite/software/kgap-core/thirdparty/picard/ValidateSamFile.jar INPUT=ars200000001.sorted.markDup.bam OUTPUT=ars200000001.sorted.validation.txt IGNORE=INVALID_FLAG_PROPER_PAIR IGNORE=INVALID_FLAG_FIRST_OF_PAIR IGNORE=INVALID_FLAG_SECOND_OF_PAIR IGNORE=INVALID_FLAG_READ_UNMAPPED IGNORE=INVALID_MAPPING_QUALITY IGNORE=INVALID_CIGAR IGNORE=INVALID_ALIGNMENT_START REFERENCE_SEQUENCE=/kfs/aligncall/refdata/human_hg19_full.fasta IGNORE_WARNINGS=True MODE=SUMMARY [Tue Mar 18 06:43:56 EDT 2014] net.sf.picard.sam.ValidateSamFile INPUT=ars200000001.sorted.markDup.bam OUTPUT=ars200000001.sorted.validation.txt MODE=SUMMARY IGNORE=[INVALID_FLAG_PROPER_PAIR, INVALID_FLAG_FIRST_OF_PAIR, INVALID_FLAG_SECOND_OF_PAIR, INVALID_FLAG_READ_UNMAPPED, INVALID_MAPPING_QUALITY, INVALID_CIGAR, INVALID_ALIGNMENT_START] REFERENCE_SEQUENCE=/kfs/aligncall/refdata/human_hg19_full.fasta IGNORE_WARNINGS=true MAX_OUTPUT=100 VALIDATE_INDEX=true IS_BISULFITE_SEQUENCED=false MAX_OPEN_TEMP_FILES=8000 VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false [Tue Mar 18 06:43:56 EDT 2014] Executing as on Linux 2.6.32-279.el6.x86_64 amd64; OpenJDK 64-Bit Server VM 1.7.0_45-mockbuild_2013_12_10_15_14-b00 INFO 2014-03-18 06:49:54 SamFileValidator 10000000 reads validated. INFO 2014-03-18 06:54:24 SamFileValidator 20000000 reads validated. INFO 2014-03-18 06:58:43 SamFileValidator 30000000 reads validated. INFO 2014-03-18 07:04:12 SamFileValidator 40000000 reads validated. INFO 2014-03-18 07:08:55 SamFileValidator 50000000 reads validated. INFO 2014-03-18 07:13:11 SamFileValidator 60000000 reads validated. [Tue Mar 18 07:17:34 EDT 2014] net.sf.picard.sam.ValidateSamFile done. Elapsed time: 33.65 minutes. Runtime.totalMemory()=962068480 Exception in thread "main" net.sf.picard.PicardException: Value was put into PairInfoMap more than once. 1: HSQ1009_86:6:1204:6504:189329 at net.sf.picard.sam.CoordinateSortedPairInfoMap.ensureSequenceLoaded( at net.sf.picard.sam.CoordinateSortedPairInfoMap.remove( at net.sf.picard.sam.SamFileValidator$CoordinateSortedPairEndInfoMap.remove( at net.sf.picard.sam.SamFileValidator.validateMateFields( at net.sf.picard.sam.SamFileValidator.validateSamRecords( at net.sf.picard.sam.SamFileValidator.validateSamFile( at net.sf.picard.sam.SamFileValidator.validateSamFileSummary( at net.sf.picard.sam.ValidateSamFile.doWork( at net.sf.picard.cmdline.CommandLineProgram.instanceMain( at net.sf.picard.sam.ValidateSamFile.main(

  6. Executed "MarkDuplicates" for the input bam file ars200000001.sorted.markDup.bam and got the output file: ars200000001.sorted.aftermarkDup.bam

    Command: java -Xmx4g -jar /kfs/aligncall/picard-tools-1.98/MarkDuplicates.jar INPUT=ars200000001.sorted.markDup.bam TMP_DIR=tmp OUTPUT=ars200000001.sorted.aftermarkDup.bam METRICS_FILE=ars200000001.DuplicateMetrics.txt COMPRESSION_LEVEL=1 VALIDATION_STRINGENCY=SILENT VERBOSITY=INFO CREATE_INDEX=true

    INFO 2014-03-19 04:09:02 MarkDuplicates Written 730,000,000 records. Elapsed time: 05:24:27s. Time for last 10,000,000: 268s. Last read position: 17:72,782,111 INFO 2014-03-19 04:13:30 MarkDuplicates Written 740,000,000 records. Elapsed time: 05:28:55s. Time for last 10,000,000: 267s. Last read position: 18:26,345,729 INFO 2014-03-19 04:17:55 MarkDuplicates Written 750,000,000 records. Elapsed time: 05:33:20s. Time for last 10,000,000: 264s. Last read position: 18:61,126,873 INFO 2014-03-19 04:22:27 MarkDuplicates Written 760,000,000 records. Elapsed time: 05:37:52s. Time for last 10,000,000: 272s. Last read position: 19:19,279,802 INFO 2014-03-19 04:27:14 MarkDuplicates Written 770,000,000 records. Elapsed time: 05:42:39s. Time for last 10,000,000: 286s. Last read position: 19:54,065,077 INFO 2014-03-19 04:31:54 MarkDuplicates Written 780,000,000 records. Elapsed time: 05:47:19s. Time for last 10,000,000: 279s. Last read position: 20:32,354,929 INFO 2014-03-19 04:36:20 MarkDuplicates Written 790,000,000 records. Elapsed time: 05:51:46s. Time for last 10,000,000: 266s. Last read position: 21:10,975,875 INFO 2014-03-19 04:40:53 MarkDuplicates Written 800,000,000 records. Elapsed time: 05:56:18s. Time for last 10,000,000: 272s. Last read position: 22:16,091,944 INFO 2014-03-19 04:45:33 MarkDuplicates Written 810,000,000 records. Elapsed time: 06:00:58s. Time for last 10,000,000: 280s. Last read position: X:1,598,647 INFO 2014-03-19 04:50:08 MarkDuplicates Written 820,000,000 records. Elapsed time: 06:05:33s. Time for last 10,000,000: 274s. Last read position: X:37,449,263 INFO 2014-03-19 04:54:36 MarkDuplicates Written 830,000,000 records. Elapsed time: 06:10:01s. Time for last 10,000,000: 268s. Last read position: X:71,876,186 INFO 2014-03-19 04:59:00 MarkDuplicates Written 840,000,000 records. Elapsed time: 06:14:25s. Time for last 10,000,000: 263s. Last read position: X:107,521,203 INFO 2014-03-19 05:03:15 MarkDuplicates Written 850,000,000 records. Elapsed time: 06:18:40s. Time for last 10,000,000: 254s. Last read position: X:142,968,884 INFO 2014-03-19 05:07:55 MarkDuplicates Written 860,000,000 records. Elapsed time: 06:23:20s. Time for last 10,000,000: 280s. Last read position: 7_gl000195_random:34,336 INFO 2014-03-19 05:12:20 MarkDuplicates Written 870,000,000 records. Elapsed time: 06:27:45s. Time for last 10,000,000: 264s. Last read position: / INFO 2014-03-19 05:13:49 MarkDuplicates Before output close freeMemory: 3092103112; totalMemory: 3100639232; maxMemory: 3817865216 INFO 2014-03-19 05:13:50 MarkDuplicates After output close freeMemory: 3092116416; totalMemory: 3100639232; maxMemory: 3817865216 [Wed Mar 19 05:13:50 EDT 2014] net.sf.picard.sam.MarkDuplicates done. Elapsed time: 664.43 minutes. Runtime.totalMemory()=3100639232

  7. Validated bam file ars200000001.sorted.aftermarkDup.bam created after MarkDuplicates:

Command: java -Xmx48g -jar /knome-pd/fbaby/isys/ksuite/software/kgap-core/thirdparty/picard/ValidateSamFile.jar INPUT=ars200000001.sorted.aftermarkDup.bam OUTPUT=ars200000001.sorted.validation.txt IGNORE=INVALID_FLAG_PROPER_PAIR IGNORE=INVALID_FLAG_FIRST_OF_PAIR IGNORE=INVALID_FLAG_SECOND_OF_PAIR IGNORE=INVALID_FLAG_READ_UNMAPPED IGNORE=INVALID_MAPPING_QUALITY IGNORE=INVALID_CIGAR IGNORE=INVALID_ALIGNMENT_START REFERENCE_SEQUENCE=/knome-pd/fbaby/isys/ksuite/refdata/refgenome/hg19/human_hg19_full.fasta IGNORE_WARNINGS=True MODE=SUMMARY [Wed Mar 19 05:28:39 EDT 2014] net.sf.picard.sam.ValidateSamFile INPUT=ars200000001.sorted.aftermarkDup.bam OUTPUT=ars200000001.sorted.validation.txt MODE=SUMMARY IGNORE=[INVALID_FLAG_PROPER_PAIR, INVALID_FLAG_FIRST_OF_PAIR, INVALID_FLAG_SECOND_OF_PAIR, INVALID_FLAG_READ_UNMAPPED, INVALID_MAPPING_QUALITY, INVALID_CIGAR, INVALID_ALIGNMENT_START] REFERENCE_SEQUENCE=/knome-pd/fbaby/isys/ksuite/refdata/refgenome/hg19/human_hg19_full.fasta IGNORE_WARNINGS=true MAX_OUTPUT=100 VALIDATE_INDEX=true IS_BISULFITE_SEQUENCED=false MAX_OPEN_TEMP_FILES=8000 VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false [Wed Mar 19 05:28:39 EDT 2014] Executing as on Linux 2.6.32-279.el6.x86_64 amd64; OpenJDK 64-Bit Server VM 1.7.0_45-mockbuild_2013_12_10_15_14-b00 INFO 2014-03-19 05:31:25 SamFileValidator 10000000 reads validated. INFO 2014-03-19 05:34:15 SamFileValidator 20000000 reads validated. INFO 2014-03-19 05:36:57 SamFileValidator 30000000 reads validated. INFO 2014-03-19 05:40:14 SamFileValidator 40000000 reads validated. INFO 2014-03-19 05:42:58 SamFileValidator 50000000 reads validated. INFO 2014-03-19 05:45:28 SamFileValidator 60000000 reads validated. [Wed Mar 19 05:48:03 EDT 2014] net.sf.picard.sam.ValidateSamFile done. Elapsed time: 19.41 minutes. Runtime.totalMemory()=3423600640 Exception in thread "main" net.sf.picard.PicardException: Value was put into PairInfoMap more than once. 1: HSQ1009_86:6:1204:6504:189329 at net.sf.picard.sam.CoordinateSortedPairInfoMap.ensureSequenceLoaded( at net.sf.picard.sam.CoordinateSortedPairInfoMap.remove( at net.sf.picard.sam.SamFileValidator$CoordinateSortedPairEndInfoMap.remove( at net.sf.picard.sam.SamFileValidator.validateMateFields( at net.sf.picard.sam.SamFileValidator.validateSamRecords( at net.sf.picard.sam.SamFileValidator.validateSamFile( at net.sf.picard.sam.SamFileValidator.validateSamFileSummary( at net.sf.picard.sam.ValidateSamFile.doWork( at net.sf.picard.cmdline.CommandLineProgram.instanceMain( at net.sf.picard.sam.ValidateSamFile.main(

Expected Result:


  1. Error free run of "Local Re-align" step which outputs ars200000001.sorted.markDup.cleaned.bam
ADD COMMENTlink modified 5.0 years ago • written 5.0 years ago by febz.babz0
gravatar for Philipp Bayer
5.0 years ago by
Philipp Bayer6.0k
Philipp Bayer6.0k wrote:

A guess:

By default, MarkDuplicates doesn't remove duplicates - REMOVE_DUPLICATES is by default false (source), try running that step with REMOVE_DUPLICATES=true

ADD COMMENTlink written 5.0 years ago by Philipp Bayer6.0k

Thank you... Philipp.

I tried executing local realign step using REMOVE_DUPLICATES=true as show below:

Command: java -Xmx2g -jar /kfs/aligncall/picard-tools-1.98/MarkDuplicates.jar INPUT=ars200000001.sorted.markDup.bam TMP_DIR=tmp OUTPUT=ars200000001.sorted.aftermarkDup.bam METRICS_FILE=ars200000001.DuplicateMetrics.txt COMPRESSION_LEVEL=1 VALIDATION_STRINGENCY=SILENT VERBOSITY=INFO CREATE_INDEX=true REMOVE_DUPLICATES=true

INFO 2014-03-20 17:10:19 MarkDuplicates Written 710,000,000 records. Elapsed time: 05:00:12s. Time for last 10,000,000: 261s. Last read position: 17:54,249,836 INFO 2014-03-20 17:14:31 MarkDuplicates Written 720,000,000 records. Elapsed time: 05:04:25s. Time for last 10,000,000: 252s. Last read position: 18:8,012,175 INFO 2014-03-20 17:18:43 MarkDuplicates Written 730,000,000 records. Elapsed time: 05:08:36s. Time for last 10,000,000: 251s. Last read position: 18:43,724,924 INFO 2014-03-20 17:23:09 MarkDuplicates Written 740,000,000 records. Elapsed time: 05:13:03s. Time for last 10,000,000: 266s. Last read position: 19:950,467 INFO 2014-03-20 17:27:25 MarkDuplicates Written 750,000,000 records. Elapsed time: 05:17:19s. Time for last 10,000,000: 256s. Last read position: 19:37,788,890 INFO 2014-03-20 17:31:35 MarkDuplicates Written 760,000,000 records. Elapsed time: 05:21:29s. Time for last 10,000,000: 249s. Last read position: 20:14,527,679 INFO 2014-03-20 17:35:45 MarkDuplicates Written 770,000,000 records. Elapsed time: 05:25:38s. Time for last 10,000,000: 249s. Last read position: 20:51,859,009 INFO 2014-03-20 17:40:12 MarkDuplicates Written 780,000,000 records. Elapsed time: 05:30:05s. Time for last 10,000,000: 266s. Last read position: 21:32,591,661 INFO 2014-03-20 17:44:26 MarkDuplicates Written 790,000,000 records. Elapsed time: 05:34:20s. Time for last 10,000,000: 254s. Last read position: 22:36,157,745 INFO 2014-03-20 17:48:42 MarkDuplicates Written 800,000,000 records. Elapsed time: 05:38:36s. Time for last 10,000,000: 255s. Last read position: X:22,419,290 INFO 2014-03-20 17:52:51 MarkDuplicates Written 810,000,000 records. Elapsed time: 05:42:45s. Time for last 10,000,000: 249s. Last read position: X:58,186,009 INFO 2014-03-20 17:57:19 MarkDuplicates Written 820,000,000 records. Elapsed time: 05:47:12s. Time for last 10,000,000: 267s. Last read position: X:93,227,483 INFO 2014-03-20 18:01:29 MarkDuplicates Written 830,000,000 records. Elapsed time: 05:51:23s. Time for last 10,000,000: 250s. Last read position: X:128,716,582 INFO 2014-03-20 18:05:49 MarkDuplicates Written 840,000,000 records. Elapsed time: 05:55:43s. Time for last 10,000,000: 260s. Last read position: MT:5,083 INFO 2014-03-20 18:10:02 MarkDuplicates Written 850,000,000 records. Elapsed time: 05:59:56s. Time for last 10,000,000: 253s. Last read position: Un_gl000225:25,694 INFO 2014-03-20 18:12:37 MarkDuplicates Before output close freeMemory: 1590154544; totalMemory: 1594884096; maxMemory: 1908932608 INFO 2014-03-20 18:12:38 MarkDuplicates After output close freeMemory: 1590167848; totalMemory: 1594884096; maxMemory: 1908932608 [Thu Mar 20 18:12:38 EDT 2014] net.sf.picard.sam.MarkDuplicates done. Elapsed time: 611.05 minutes. Runtime.totalMemory()=1594884096

After which I validated the bam file and got the same error as before:

Command: java -Xmx48g -jar /knome-pd/fbaby/isys/ksuite/software/kgap-core/thirdparty/picard/ValidateSamFile.jar INPUT=ars200000001.sorted.aftermarkDup.bam OUTPUT=ars200000001.sorted.aftermarkup.validation.txt IGNORE=INVALID_FLAG_PROPER_PAIR IGNORE=INVALID_FLAG_FIRST_OF_PAIR IGNORE=INVALID_FLAG_SECOND_OF_PAIR IGNORE=INVALID_FLAG_READ_UNMAPPED IGNORE=INVALID_MAPPING_QUALITY IGNORE=INVALID_CIGAR IGNORE=INVALID_ALIGNMENT_START REFERENCE_SEQUENCE=/kfs/aligncall/refdata/human_hg19_full.fasta IGNORE_WARNINGS=True MODE=SUMMARY [Fri Mar 21 05:25:48 EDT 2014] net.sf.picard.sam.ValidateSamFile INPUT=ars200000001.sorted.aftermarkDup.bam OUTPUT=ars200000001.sorted.aftermarkup.validation.txt MODE=SUMMARY IGNORE=[INVALID_FLAG_PROPER_PAIR, INVALID_FLAG_FIRST_OF_PAIR, INVALID_FLAG_SECOND_OF_PAIR, INVALID_FLAG_READ_UNMAPPED, INVALID_MAPPING_QUALITY, INVALID_CIGAR, INVALID_ALIGNMENT_START] REFERENCE_SEQUENCE=/kfs/aligncall/refdata/human_hg19_full.fasta IGNORE_WARNINGS=true MAX_OUTPUT=100 VALIDATE_INDEX=true IS_BISULFITE_SEQUENCED=false MAX_OPEN_TEMP_FILES=8000 VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false [Fri Mar 21 05:25:48 EDT 2014] Executing as on Linux 2.6.32-279.el6.x86_64 amd64; OpenJDK 64-Bit Server VM 1.7.0_45-mockbuild_2013_12_10_15_14-b00 INFO 2014-03-21 05:30:07 SamFileValidator 10000000 reads validated. INFO 2014-03-21 05:33:50 SamFileValidator 20000000 reads validated. INFO 2014-03-21 05:37:23 SamFileValidator 30000000 reads validated. INFO 2014-03-21 05:41:46 SamFileValidator 40000000 reads validated. INFO 2014-03-21 05:45:28 SamFileValidator 50000000 reads validated. INFO 2014-03-21 05:49:06 SamFileValidator 60000000 reads validated. [Fri Mar 21 05:51:56 EDT 2014] net.sf.picard.sam.ValidateSamFile done. Elapsed time: 26.14 minutes. Runtime.totalMemory()=713031680 Exception in thread "main" net.sf.picard.PicardException: Value was put into PairInfoMap more than once. 1: HSQ1009_86:6:1204:6504:189329 at net.sf.picard.sam.CoordinateSortedPairInfoMap.ensureSequenceLoaded( at net.sf.picard.sam.CoordinateSortedPairInfoMap.remove( at net.sf.picard.sam.SamFileValidator$CoordinateSortedPairEndInfoMap.remove( at net.sf.picard.sam.SamFileValidator.validateMateFields( at net.sf.picard.sam.SamFileValidator.validateSamRecords( at net.sf.picard.sam.SamFileValidator.validateSamFile( at net.sf.picard.sam.SamFileValidator.validateSamFileSummary( at net.sf.picard.sam.ValidateSamFile.doWork( at net.sf.picard.cmdline.CommandLineProgram.instanceMain( at net.sf.picard.sam.ValidateSamFile.main(

ADD REPLYlink modified 5.0 years ago • written 5.0 years ago by febz.babz0

Have a look at these threads, there are several solutions:

MarkDuplicates: Value was put into PairInfoMap more than once

ADD REPLYlink written 5.0 years ago by Philipp Bayer6.0k
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 915 users visited in the last hour