Parse Web Blast Output

Question

[Empyrean]

I have installed NCBI wwwblast at our local server and blast is running absolutely fine. I wanted to refine the html output which the blast is showing. For example, while showing alignment description, i wanted to make the "Subjcet" as a hyperlink and guide it to show in gbrowse. Can anyone suggest me how to achieve this?

For example, the default output is shown below.

    >gb|FJ032364.1| hypothetical resistant gene, complete
           cds
          Length = 1905

 Score =  634 bits (320), Expect = e-179
 Identities = 320/320 (100%)
 Strand = Plus / Plus


Query: 1   atgaatagtgtattgaatactggaagaactactatttgtgatgcgtataatgtagcggct 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   atgaatagtgtattgaatactggaagaactactatttgtgatgcgtataatgtagcggct 60

I would like to see "Sbjct:" as a hyperlink created by me. I have the www libraries but dont know which one to change this.. Please some one suggest me.

Answer 1

[Yannick Wurm]

Sequenceserver is an alternative to ncbi's wwwblast. Ben Woodcroft recently added precisely the feature you request:

In the customization.rb file, uncomment the construct_custom_sequence_hyperlinking_line method and implement your changes there

[Yannick Wurm]

the file is now links.rb

Answer 2

[Yogesh Pandit]

BLAST Output Visualization Tool (BOV), allows users to interactively visualize the matching regions of query and database hit sequences, thereby allowing the user to quickly and easily dissect complex matching patterns.

Answer 3

[Dvhh]

I would recommend using the xml output (-m 7) and use XSLT which would help you format the information the way you want.