seqtk subseq in.fastq list.txt > out.fastq not extracting full sequence from input file
1
0
Entering edit mode
4 weeks ago

My in.fastq file is this:

@A00869:294:HCW57DSXY:2:1101:3929:1000 1:N:0:ACTGGACA+ACTGGACA
GCCACTCTGGCTATGTGAATACGGTGGCGGTGTCGCCTGATGGGTCGCTTTGCGCGAGCGGAGGGAAAGATGGGACTATTTTGTTGTGGGACTTGTCGGAGGGCAAGAGGCTTTACTCGCTCGATGCTGGCTCGATCATTAATGCTCTC
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFF
@A00869:294:HCW57DSXY:2:1101:5882:1000 1:N:0:ACTGGACA+ACTGGACA
TTTTGCCTAGTTTCTTCATTGTTGGGTCGTTTCACAACTCATGCTGTTGGGTCGGAGGCTATTGGGATTCTTGTGAATTTCGATCTCAATTCGGAATCGATAACCAATTTGATGCAACCTGCGAAGGTATCGTTAATGGTGGACATGTT
+
FFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFF,FFFFFFFFFF:FFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF

My ID list is this:

A00869:294:HCW57DSXY:2:1101:3929:1000 1:N:0:ACTGGACA+ACTGGACA

A00869:294:HCW57DSXY:2:1101:5882:1000 1:N:0:ACTGGACA+ACTGGACA

A00869:294:HCW57DSXY:2:1101:5882:1000 1:N:0:ACTGGACA+ACTGGACA

I am using the above subject command correctly but the output file does not contain the full sequence. The output file sequence contains like this:

@A00869:294:HCW57DSXY:2:1101:3929:1000 1:N:0:ACTGGACA+ACTGGACA

A

+

F

@A00869:294:HCW57DSXY:2:1101:5882:1000 1:N:0:ACTGGACA+ACTGGACA

A

+

F

@A00869:294:HCW57DSXY:2:1101:5882:1000 1:N:0:ACTGGACA+ACTGGACA

T

+

F

Anyone can explain why output file not containing the full sequence but only one basepair with each ID?

subseq seqtk extractionproblem • 299 views
ADD COMMENT
1
Entering edit mode
4 weeks ago
ATpoint 83k

Use everything before the whitespace in list.txt, for example A00869:294:HCW57DSXY:2:1101:3929:1000 and not A00869:294:HCW57DSXY:2:1101:3929:1000 1:N:0:ACTGGACA+ACTGGACA.

https://github.com/lh3/seqtk/issues/180

ADD COMMENT
0
Entering edit mode

Thank you it works

ADD REPLY
0
Entering edit mode

Please accept the answer (green check mark) to provide closure to this thread.

ADD REPLY

Login before adding your answer.

Traffic: 2899 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6