Raw Alignment Score Calculation
1
2
Entering edit mode
10.3 years ago
Beeth ▴ 170

Thanks for lots of answers and I've started with lots of sources here. It helps me to get a good introduction to blast.

After I've now a little more understanding I can ask more specific questions such as the following:

The following blast result:

ATTTGCAGAATTTGCAAAAAAATGTTTGT
|||||||||||||||    ||||||||||
ATTTGCAGAATTTGC----AAATGTTTGT

I'd like to calculate the raw alignment score: (Scoring scheme: match=1, mismatch= -2, opening gap= 3, extented gap=2)

We have 25 matches and 4 gaps. S = 25-9 = 16 or do I need to say: there are 4 gaps which are 4 mismatches and therefore we get the following raw score: S = 25-9-8= 8

Which one is correct?

Thanks! Beeth.

blast scoring • 11k views
ADD COMMENT
6
Entering edit mode
10.3 years ago
Gww ★ 2.7k

In your scoring scheme you are using an affine gap penalty. Therefore your score should be:

25 - ([opening penalty] + [gap extension] * (l - 1)) = 25 - (3 + 2 * 3) = 16

Where l is the length of the gap. The mismatch score is only used when the aligned bases mismatch outside of a gap.

ADD COMMENT
0
Entering edit mode

Note that BLAST is bit more complicated than this, and scales match/mismatch scores by the nucleotide's frequency in the data set (i.e. if A's are more frequent in general than G's, then matching a T to an A is going to be cheaper than matching it to a a G). Isn't Karlin-Altschul also doing some adjustment for sequence lengths?

ADD REPLY

Login before adding your answer.

Traffic: 1865 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6