Question: Raw Alignment Score Calculation
2
gravatar for Beeth
8.8 years ago by
Beeth170
Beeth170 wrote:

Thanks for lots of answers and I've started with lots of sources here. It helps me to get a good introduction to blast.

After I've now a little more understanding I can ask more specific questions such as the following:

The following blast result:

ATTTGCAGAATTTGCAAAAAAATGTTTGT
|||||||||||||||    ||||||||||
ATTTGCAGAATTTGC----AAATGTTTGT

I'd like to calculate the raw alignment score: (Scoring scheme: match=1, mismatch= -2, opening gap= 3, extented gap=2)

We have 25 matches and 4 gaps. S = 25-9 = 16 or do I need to say: there are 4 gaps which are 4 mismatches and therefore we get the following raw score: S = 25-9-8= 8

Which one is correct?

Thanks! Beeth.

scoring blast • 7.8k views
ADD COMMENTlink written 8.8 years ago by Beeth170
6
gravatar for Gww
8.8 years ago by
Gww2.7k
Canada
Gww2.7k wrote:

In your scoring scheme you are using an affine gap penalty. Therefore your score should be:

25 - ([opening penalty] + [gap extension] * (l - 1)) = 25 - (3 + 2 * 3) = 16

Where l is the length of the gap. The mismatch score is only used when the aligned bases mismatch outside of a gap.

ADD COMMENTlink written 8.8 years ago by Gww2.7k

Note that BLAST is bit more complicated than this, and scales match/mismatch scores by the nucleotide's frequency in the data set (i.e. if A's are more frequent in general than G's, then matching a T to an A is going to be cheaper than matching it to a a G). Isn't Karlin-Altschul also doing some adjustment for sequence lengths?

ADD REPLYlink written 8.8 years ago by Ketil4.0k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1790 users visited in the last hour