Question: Can Anyone Suggest Me A Program For Converting Dot-Bracket Notation Format To Standard Hybridization Format.
0
gravatar for gauravdube007
6.5 years ago by
India
gauravdube0070 wrote:

Hello,

I am interested in converting: Dot-Bracket notation format to Standard hybridization format.

Example :

Dot-Bracket notation -

UGACGAUCAAAGGUGGGCCACU&GUGGCCAACUUCUAGUCAU    
((((......((((.((((((.&)))))).))))...)))).

to Standard hybridization format -

     GAUCAA        
 UGAC      AGGUGGGCCACU    
 ||||       |:||.||||||.    
UACUG      UUCAACCGGUG    
      AUC

or possibly like this :

 UGACGAUCAAAGGUGGGCCACU
 ||||  | | ||||.||||||.
UACUG--A-UCUUCAACCGGUG
sequence format rna conversion • 2.8k views
ADD COMMENTlink written 6.5 years ago by gauravdube0070
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2247 users visited in the last hour