Error message exonerate, negative HSP score.
0
0
Entering edit mode
8.5 years ago
Myggan ▴ 20

Hello!

I'm trying to annotate a genome using exonerate.

My query is a fasta file of all reference genes, and my target is fasta file containing contigs.

I'm using the following command to run exonerate:

exonerate \
--model coding2genome \
query.fasta \
target.fasta \
--percent 90 \
--bestn 1
--score 100
--showtargetgff true \
--showalignment false \
1>output \
2>error

However, I get an error message that I would really appreciate some help in understanding what happens.

The program crashes with the last alignment run and the error message:

draw_hsp(74, 71404, 4, 0, 3, 3, "Bad HSP seed")
HSP info (0x7fff727a4f40)
    query_start  = [74]
    target_start = [71404]
    length       = [4]
    score        = [-1]
    cobs         = [0]
 ruler:[---===---===---===---===---===###---===---===###--]
 query:[gtagaacttgggcaatacttataacggcaa < TGATAATGATAA > tc]
       [   ||+    ! ... !    |+|  !!:! < |||! !|||||| > ||]
target:[tatgagaggtgttctgatagttgaatgcga < TGATTATGATAA > tc]
 ruler:[---===---===---===---===---===###---===---===###--]

 ruler:[-===---===---===---===---===]
 query:[aatatagataaccaagtcaaccttgatt]
       [|      ! !  ! ! ! !  !!     ]
target:[atgtggcaaatactattaattctgtgag]
 ruler:[-===---===---===---===---===]

sugar: YAL007C 74 12 - Chr4 71404 12 + -1

** FATAL ERROR **: Initial HSP score [-1] less than zero
exiting ...

So, I suppose that the HSP seed gets a negative score for some reason and the program crashes, I don't really see how to move on from here.

Anyone know why this is happening?

alignment annotation DNA • 2.9k views
ADD COMMENT
2
Entering edit mode

Hi

I am as well facing the same issue and it seems to be only persistent with the mode "coding2genome". If I use instead est2genome it succeeds successfully. The manual states:

This is similar to the est2genome model, except that the query sequence is translated during comparison, allowing a more sensitive comparison.

So I guess currently one has to use est2genome instead ....

ADD REPLY
0
Entering edit mode

Hi Myggan,

Did you find answer for your error?

ADD REPLY

Login before adding your answer.

Traffic: 2291 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6