Question: Error message exonerate, negative HSP score.
gravatar for Myggan
3.9 years ago by
Myggan20 wrote:


I'm trying to annotate a genome using exonerate.

My query is a fasta file of all reference genes, and my target is fasta file containing contigs.

I'm using the following command to run exonerate:

exonerate \
--model coding2genome \
query.fasta \
target.fasta \
--percent 90 \
--bestn 1
--score 100
--showtargetgff true  \
--showalignment false \
1>output \


However, I get an error message that I would really appreciate some help in understanding what happens.

The program crashes with the last alignment run and the error message:

draw_hsp(74, 71404, 4, 0, 3, 3, "Bad HSP seed")
HSP info (0x7fff727a4f40)
    query_start  = [74]
    target_start = [71404]
    length       = [4]
    score        = [-1]
    cobs         = [0]
 query:[gtagaacttgggcaatacttataacggcaa < TGATAATGATAA > tc]
       [   ||+    ! ... !    |+|  !!:! < |||! !|||||| > ||]
target:[tatgagaggtgttctgatagttgaatgcga < TGATTATGATAA > tc]

       [|      ! !  ! ! ! !  !!     ]

sugar: YAL007C 74 12 - Chr4 71404 12 + -1

** FATAL ERROR **: Initial HSP score [-1] less than zero

exiting ...


So, I suppose that the HSP seed gets a negtive score for some reason and the program crashes, I don't really see how to move on from here.

Anyone know why this is happening?


dna alignment annotation • 1.5k views
ADD COMMENTlink modified 3.9 years ago by Biostar ♦♦ 20 • written 3.9 years ago by Myggan20


I am as well facing the same issue and it seems to be only persistent with the mode "coding2genome". If I use instead est2genome it succeeds successfully. The manual states: 

This is similar to the est2genome model, except that the query sequence is translated during comparison, allowing a more sensitive comparison.

So I guess currently one has to use est2genome instead ....

ADD REPLYlink written 2.6 years ago by schmidemanuel10

Hi Myggan, 

Did you find answer for your error? 

ADD REPLYlink written 3.0 years ago by amoltej80
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1575 users visited in the last hour